Mutagenetix > Incidental Mutations

Incidental Mutation 'R0143:Arhgef12'

22447

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

038428-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.932) question?

Stock #

R0143 (G1)

Quality Score

225

Status

Validated (trace)

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 43005594 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 419 (T419A)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

Predicted Effect

probably damaging
Transcript: ENSMUST00000072767
AA Change: T418A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: T418A

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: T419A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: T419A

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Meta Mutation Damage Score

0.1219

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.6%
20x: 93.6%

Validation Efficiency

97% (76/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Ablim3	A	T	18: 61,855,217	I145N	probably benign	Het
Ankrd1	G	A	19: 36,119,313	A38V	probably benign	Het
Ankrd34b	A	G	13: 92,439,760	E500G	probably damaging	Het
B3galt2	A	T	1: 143,647,334	N403Y	possibly damaging	Het
Bbx	C	T	16: 50,280,392	E47K	probably benign	Het
C4b	G	A	17: 34,734,219		probably benign	Het
Cacna1e	A	T	1: 154,448,947		probably null	Het
Cdh3	T	C	8: 106,511,225	V17A	probably benign	Het
Cog7	A	T	7: 121,951,164	L379Q	probably damaging	Het
Cul9	T	C	17: 46,526,410	N1044S	possibly damaging	Het
Cyp4b1	C	T	4: 115,635,874	D258N	probably damaging	Het
Ddx39	T	C	8: 83,720,550	V113A	probably benign	Het
Dennd4b	A	T	3: 90,272,364	H643L	probably damaging	Het
Dpy19l3	T	C	7: 35,714,215	T334A	probably benign	Het
Dsg3	T	C	18: 20,536,825	L632S	probably damaging	Het
Dtx4	G	A	19: 12,486,482	T312I	probably damaging	Het
Dusp18	C	T	11: 3,897,243	R78C	probably benign	Het
Fes	A	C	7: 80,383,895	F203V	probably benign	Het
Fhad1	C	A	4: 141,929,646		probably benign	Het
Gjb2	T	C	14: 57,100,069		silent	Het
Gm5828	T	C	1: 16,768,355		noncoding transcript	Het
Gsdma	A	C	11: 98,666,254	E65A	probably damaging	Het
Hck	T	A	2: 153,134,220		probably null	Het
Henmt1	A	T	3: 108,953,802	H47L	probably damaging	Het
Hivep2	T	C	10: 14,129,355	F566L	probably damaging	Het
Hnrnpl	T	C	7: 28,814,192		probably benign	Het
Igsf3	T	C	3: 101,435,601	I518T	probably damaging	Het
Ireb2	T	C	9: 54,885,909	F223L	probably benign	Het
Isoc2a	T	C	7: 4,891,332		probably null	Het
Krt73	T	A	15: 101,800,773	R200W	probably damaging	Het
Lgals9	T	A	11: 78,963,535	I308F	probably damaging	Het
Lrp1	A	G	10: 127,593,942	F420L	probably damaging	Het
Mep1b	T	C	18: 21,095,107		probably benign	Het
Mex3a	G	T	3: 88,536,255	A213S	probably benign	Het
Mmp13	T	C	9: 7,276,558	F218L	probably damaging	Het
Ncf1	G	T	5: 134,227,137		probably benign	Het
Notch2	A	G	3: 98,146,117	D2032G	probably damaging	Het
Olfr1505	A	C	19: 13,919,250	I77L	probably damaging	Het
Olfr491	A	G	7: 108,316,995	I34V	probably benign	Het
Olfr63	T	C	17: 33,269,497	S258P	probably damaging	Het
Pex16	G	A	2: 92,380,457	G312D	probably damaging	Het
Pex5	A	T	6: 124,398,489	W525R	probably damaging	Het
Plcb4	T	A	2: 135,976,211	I799N	probably damaging	Het
Poldip3	G	A	15: 83,127,943	L372F	probably damaging	Het
Polg2	C	A	11: 106,777,526	V174L	probably benign	Het
Prrt4	C	G	6: 29,170,671	G594A	probably damaging	Het
Prss1	A	G	6: 41,463,588	D199G	probably damaging	Het
Rbms2	T	A	10: 128,137,954	Q207L	probably benign	Het
Retreg2	A	G	1: 75,146,430	D334G	possibly damaging	Het
Slc6a15	T	G	10: 103,418,068	C622G	probably benign	Het
Spdya	T	A	17: 71,558,640	D84E	probably damaging	Het
Stat3	A	T	11: 100,895,156	S432T	possibly damaging	Het
Tiam1	A	T	16: 89,898,200	V123E	probably benign	Het
Tnpo3	A	G	6: 29,565,652		probably benign	Het
Tnrc6c	A	C	11: 117,752,985	N1481H	probably damaging	Het
Top3b	T	C	16: 16,883,525	S234P	probably damaging	Het
Tor1aip2	A	T	1: 156,059,548	T10S	probably benign	Het
Tpsab1	T	A	17: 25,343,444	H303L	probably benign	Het
Traf3	T	A	12: 111,261,576	V407D	probably damaging	Het
Trim33	T	A	3: 103,352,101	D1035E	probably benign	Het
Ttc38	T	C	15: 85,853,719	V402A	possibly damaging	Het
Ube4b	C	T	4: 149,355,457	R646H	possibly damaging	Het
Usp8	C	A	2: 126,755,089		probably benign	Het
Zdbf2	A	T	1: 63,308,074	I1871F	probably benign	Het
Zfp345	T	A	2: 150,472,555	Q354L	probably benign	Het
Zfp462	C	A	4: 55,023,402		probably benign	Het
Zfp81	G	A	17: 33,335,121	H240Y	possibly damaging	Het
Zfp830	A	G	11: 82,765,168	D266G	possibly damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7658:Arhgef12	UTSW	9	42992536	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- CAAAGCGCAGCAATTCGCTGAC -3'
(R):5'- CACAGTTTGACCCTGCAACATTGG -3'

Sequencing Primer
(F):5'- GGGCCACTCAGAATTCAGTTATC -3'
(R):5'- TGATTGAGCAGCCACATACTG -3'

Posted On

2013-04-16