Incidental Mutation 'R2037:Ncf1'
ID224765
Institutional Source Beutler Lab
Gene Symbol Ncf1
Ensembl Gene ENSMUSG00000015950
Gene Nameneutrophil cytosolic factor 1
Synonymsp47, Ncf-1, NOXO2, NADPH oxidase subunit (47kDa), p47phox
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2037 (G1)
Quality Score118
Status Not validated
Chromosome5
Chromosomal Location134220053-134229625 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 134229552 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 6 (I6V)
Ref Sequence ENSEMBL: ENSMUSP00000138121 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016094] [ENSMUST00000111275] [ENSMUST00000144086] [ENSMUST00000146354]
Predicted Effect probably damaging
Transcript: ENSMUST00000016094
AA Change: I6V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000016094
Gene: ENSMUSG00000015950
AA Change: I6V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 403 1.3e-22 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111275
AA Change: I6V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000106906
Gene: ENSMUSG00000015950
AA Change: I6V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126934
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139249
Predicted Effect possibly damaging
Transcript: ENSMUST00000144086
AA Change: I6V

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000138547
Gene: ENSMUSG00000015950
AA Change: I6V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
low complexity region 336 344 N/A INTRINSIC
low complexity region 349 367 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000146354
AA Change: I6V

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000138121
Gene: ENSMUSG00000015950
AA Change: I6V

DomainStartEndE-ValueType
PX 4 121 2.14e-25 SMART
SH3 159 214 2.17e-17 SMART
SH3 229 284 1.02e-13 SMART
Pfam:p47_phox_C 332 390 5.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a 47 kDa cytosolic subunit of neutrophil NADPH oxidase. This oxidase is a multicomponent enzyme that is activated to produce superoxide anion. Mutations in this gene have been associated with chronic granulomatous disease. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene causes severe spontaneous infections and granulomatous inflammation and may alter synaptic plasticity and memory, RAS activation, blood pressure control, airway smooth muscle function, neointima formation, vasoconstriction and the response to myocardial infarction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Ssb A G 2: 69,868,819 S199G probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Ncf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Ncf1 APN 5 134226593 missense probably benign 0.03
IGL02718:Ncf1 APN 5 134227448 critical splice donor site probably null
R0143:Ncf1 UTSW 5 134227137 splice site probably benign
R0313:Ncf1 UTSW 5 134229567 start codon destroyed probably null 1.00
R0413:Ncf1 UTSW 5 134222802 splice site probably benign
R2042:Ncf1 UTSW 5 134226640 missense probably benign 0.00
R2511:Ncf1 UTSW 5 134225698 missense probably damaging 0.99
R3545:Ncf1 UTSW 5 134226609 nonsense probably null
R3547:Ncf1 UTSW 5 134226609 nonsense probably null
R3548:Ncf1 UTSW 5 134226609 nonsense probably null
R4751:Ncf1 UTSW 5 134229545 missense probably damaging 1.00
R4989:Ncf1 UTSW 5 134223413 missense probably damaging 0.98
R5288:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5384:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5385:Ncf1 UTSW 5 134221805 missense probably damaging 1.00
R5590:Ncf1 UTSW 5 134223501 missense probably damaging 0.98
R6059:Ncf1 UTSW 5 134223487 missense probably damaging 1.00
R6136:Ncf1 UTSW 5 134226633 missense probably damaging 1.00
R7023:Ncf1 UTSW 5 134225262 missense possibly damaging 0.48
R7310:Ncf1 UTSW 5 134221761 missense probably benign 0.04
R7618:Ncf1 UTSW 5 134227267 missense probably benign 0.08
R7838:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
R7921:Ncf1 UTSW 5 134222095 missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- ATAGCCTCCCCTGGACCC -3'
(R):5'- CCCACCACTCTGTTGAAGCTC -3'

Sequencing Primer
(F):5'- ATATCCTCCCCTGGACCCC -3'
(R):5'- CCACTCTGTTGAAGCTCAAAAATTC -3'
Posted On2014-08-25