Incidental Mutation 'R2037:Ssb'
ID224725
Institutional Source Beutler Lab
Gene Symbol Ssb
Ensembl Gene ENSMUSG00000068882
Gene NameSjogren syndrome antigen B
SynonymsSS-B, autoantigen La, La protein
MMRRC Submission 040044-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2037 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location69861562-69871846 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 69868819 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 199 (S199G)
Ref Sequence ENSEMBL: ENSMUSP00000130313 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060447] [ENSMUST00000090852] [ENSMUST00000112260] [ENSMUST00000132186] [ENSMUST00000142127] [ENSMUST00000166411]
Predicted Effect probably benign
Transcript: ENSMUST00000060447
SMART Domains Protein: ENSMUSP00000050907
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 184 1.8e-12 PFAM
Pfam:UPF0020 25 170 3.8e-8 PFAM
Pfam:PrmA 35 127 8.4e-14 PFAM
Pfam:MTS 36 174 2.2e-16 PFAM
Pfam:Methyltransf_31 49 199 4e-15 PFAM
Pfam:Methyltransf_18 51 171 8.1e-11 PFAM
Pfam:Methyltransf_15 52 179 1.1e-9 PFAM
Pfam:Methyltransf_26 52 182 3.9e-8 PFAM
Pfam:Methyltransf_25 55 171 5.2e-8 PFAM
Pfam:Methyltransf_11 56 131 8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090852
AA Change: S199G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000088365
Gene: ENSMUSG00000068882
AA Change: S199G

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 2.2e-32 PFAM
low complexity region 375 386 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112260
SMART Domains Protein: ENSMUSP00000107879
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132186
SMART Domains Protein: ENSMUSP00000119773
Gene: ENSMUSG00000068882

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
Pfam:RRM_1 113 154 2.6e-6 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000132603
AA Change: S14G
SMART Domains Protein: ENSMUSP00000115666
Gene: ENSMUSG00000068882
AA Change: S14G

DomainStartEndE-ValueType
Pfam:RRM_3 46 149 2.5e-33 PFAM
low complexity region 190 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135459
Predicted Effect probably benign
Transcript: ENSMUST00000142127
SMART Domains Protein: ENSMUSP00000121474
Gene: ENSMUSG00000051730

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
Pfam:Cons_hypoth95 21 141 8.7e-12 PFAM
Pfam:UPF0020 24 141 1.4e-11 PFAM
Pfam:Methyltransf_16 31 126 5e-7 PFAM
Pfam:PrmA 34 127 4e-15 PFAM
Pfam:MTS 35 141 1.4e-17 PFAM
Pfam:Methyltransf_31 49 142 5.2e-15 PFAM
Pfam:Methyltransf_18 51 141 1.4e-11 PFAM
Pfam:Methyltransf_15 52 140 4.5e-9 PFAM
Pfam:Methyltransf_26 52 140 1.3e-14 PFAM
Pfam:Methyltransf_25 55 142 4.7e-8 PFAM
Pfam:Methyltransf_11 56 134 3.8e-6 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156057
Predicted Effect probably benign
Transcript: ENSMUST00000166411
AA Change: S199G

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000130313
Gene: ENSMUSG00000068882
AA Change: S199G

DomainStartEndE-ValueType
LA 11 92 2.19e-42 SMART
RRM 112 183 1.6e-4 SMART
Pfam:RRM_3 230 333 1.9e-35 PFAM
low complexity region 375 386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in diverse aspects of RNA metabolism, including binding and protecting poly(U) termini of nascent RNA polymerase III transcripts from exonuclease digestion, processing 5' and 3' ends of pre-tRNA precursors, acting as an RNA chaperone, and binding viral RNAs associated with hepatitis C virus. Autoantibodies reacting with this protein are found in the sera of patients with Sjogren syndrome and systemic lupus erythematosus. Alternative promoter usage results in two different transcript variants which encode the same protein. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos, possible before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca8a A T 11: 110,089,984 probably null Het
AI987944 T C 7: 41,374,391 Y391C probably benign Het
Ankfn1 A T 11: 89,456,120 S296T probably benign Het
Apob A G 12: 8,007,488 D1957G probably benign Het
Baz1a G T 12: 54,929,646 P415Q probably damaging Het
Brca2 T A 5: 150,540,669 H1299Q probably benign Het
C7 G T 15: 5,034,238 S227* probably null Het
Catsperb A T 12: 101,507,962 R306S probably damaging Het
Cbx3 T A 6: 51,471,813 probably null Het
Ccdc129 A G 6: 55,897,875 N270S probably benign Het
Ccnt2 A G 1: 127,803,399 Y671C probably damaging Het
Crocc A G 4: 141,046,942 probably null Het
Ctr9 G A 7: 111,046,807 V669I probably benign Het
Dck T G 5: 88,772,717 Y99D probably damaging Het
Ddx52 T A 11: 83,944,606 D119E probably benign Het
Dnah10 A T 5: 124,746,704 K596N probably benign Het
Dnah7a A T 1: 53,582,582 V1128E probably benign Het
Dph1 A T 11: 75,185,853 probably null Het
Enah G A 1: 181,921,972 P415L probably damaging Het
Enthd1 A G 15: 80,560,349 S2P possibly damaging Het
Erc1 A C 6: 119,722,255 V802G possibly damaging Het
F8 ATCTCTCTC ATCTCTC X: 75,322,998 probably null Het
Fam169a C A 13: 97,107,092 A210E probably benign Het
Fcmr A G 1: 130,878,333 D342G possibly damaging Het
Fgfr4 T G 13: 55,167,889 V743G possibly damaging Het
Fsip2 A G 2: 82,978,512 D1725G probably damaging Het
Heatr5b A T 17: 78,829,505 C195* probably null Het
Herc2 G A 7: 56,205,961 A3882T probably damaging Het
Il20 T A 1: 130,908,378 N143Y probably damaging Het
Inpp5b A G 4: 124,798,299 S892G probably damaging Het
Ipo13 A T 4: 117,904,661 Y447* probably null Het
Kbtbd12 A T 6: 88,617,797 N350K probably benign Het
Kiz T C 2: 146,969,960 F663S probably damaging Het
Matn2 A G 15: 34,433,117 D870G probably benign Het
Methig1 C T 15: 100,353,586 A126V probably benign Het
Mme A G 3: 63,328,260 D209G probably null Het
Mroh4 A G 15: 74,609,761 F811L possibly damaging Het
Myo9b G T 8: 71,290,866 K190N probably damaging Het
Ncf1 T C 5: 134,229,552 I6V probably damaging Het
Nmt2 T C 2: 3,309,581 F121L probably damaging Het
Nol10 A G 12: 17,361,151 D183G probably benign Het
Nsun7 T C 5: 66,261,086 V53A probably benign Het
Olfr1045 T C 2: 86,197,832 S307G probably benign Het
Olfr1054 T C 2: 86,332,430 N309D probably benign Het
Olfr819 T C 10: 129,966,140 I187V probably benign Het
Pappa2 A T 1: 158,956,644 Y265* probably null Het
Pigg G A 5: 108,338,652 A724T probably damaging Het
Pik3r4 C T 9: 105,650,335 R296C probably benign Het
Pkhd1l1 A G 15: 44,568,221 probably null Het
Pld4 A G 12: 112,768,558 D483G probably damaging Het
Ppip5k1 C T 2: 121,343,193 R399H probably damaging Het
Qrfpr A T 3: 36,182,657 H198Q probably damaging Het
Rasgrf2 A T 13: 91,902,629 D883E probably damaging Het
Retnlg T C 16: 48,874,252 C88R probably damaging Het
Sin3a C T 9: 57,096,825 T287I probably benign Het
Slc44a1 GCC GCCCCC 4: 53,563,243 probably benign Het
Sppl2c G C 11: 104,186,481 V36L probably benign Het
Srp72 T A 5: 76,976,491 I68N probably damaging Het
Srrm3 T A 5: 135,854,377 S195R probably damaging Het
Srrm4 T A 5: 116,467,828 probably benign Het
Sult2a6 T A 7: 14,254,709 Y42F probably damaging Het
Syne2 A G 12: 76,025,569 T120A probably benign Het
Tas1r1 A G 4: 152,028,170 F809L probably damaging Het
Tead3 A G 17: 28,336,570 S117P probably damaging Het
Tefm C T 11: 80,140,230 R60H probably damaging Het
Tmem104 G A 11: 115,201,395 R110H possibly damaging Het
Tnxb G A 17: 34,699,205 G2364D probably damaging Het
Vmn1r211 T A 13: 22,851,964 I178F probably damaging Het
Vmn1r6 A T 6: 57,003,124 Y235F probably damaging Het
Xrcc5 C A 1: 72,346,370 T540K probably benign Het
Other mutations in Ssb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00895:Ssb APN 2 69866262 missense probably benign 0.06
IGL00940:Ssb APN 2 69870835 critical splice donor site probably null
IGL00941:Ssb APN 2 69870835 critical splice donor site probably null
IGL01834:Ssb APN 2 69870803 missense possibly damaging 0.89
R0713:Ssb UTSW 2 69867359 missense probably benign 0.06
R0716:Ssb UTSW 2 69867359 missense probably benign 0.06
R0751:Ssb UTSW 2 69870565 missense probably benign
R1139:Ssb UTSW 2 69866576 missense possibly damaging 0.66
R1928:Ssb UTSW 2 69867557 splice site probably null
R3968:Ssb UTSW 2 69867449 splice site probably benign
R4674:Ssb UTSW 2 69868850 missense probably benign 0.01
R5039:Ssb UTSW 2 69866237 missense possibly damaging 0.79
R5551:Ssb UTSW 2 69871130 missense probably damaging 0.99
R6102:Ssb UTSW 2 69871208 makesense probably null
R7126:Ssb UTSW 2 69866501 missense possibly damaging 0.70
R7448:Ssb UTSW 2 69863280 missense probably benign
R7590:Ssb UTSW 2 69867290 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- GTCTCAGGTACCATGCATGC -3'
(R):5'- CTTGAGGCCAACATTTCAATTACC -3'

Sequencing Primer
(F):5'- GCAGTGGTGGCACATACCTTTAATC -3'
(R):5'- GGCCAACATTTCAATTACCAATACTG -3'
Posted On2014-08-25