Mutagenetix > Incidental Mutation

Incidental Mutation 'R0193:Pitpnm3'

23235

Institutional Source

Beutler Lab

Gene Symbol

Pitpnm3

Ensembl Gene

ENSMUSG00000040543

Gene Name

PITPNM family member 3

Synonyms

Ackr6, A330068P14Rik

MMRRC Submission

038452-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R0193 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

72047528-72135778 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

A to G at 72070492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000104148 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075258] [ENSMUST00000108508]

AlphaFold

Q3UHE1

Predicted Effect

probably benign
Transcript: ENSMUST00000075258

SMART Domains

Protein: ENSMUSP00000074737
Gene: ENSMUSG00000040543

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	128	140	N/A	INTRINSIC
Blast:DDHD	141	361	1e-105	BLAST
DDHD	390	594	1.49e-91	SMART
LNS2	739	870	2.12e-55	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000108508

SMART Domains

Protein: ENSMUSP00000104148
Gene: ENSMUSG00000040543

Domain	Start	End	E-Value	Type
low complexity region	4	17	N/A	INTRINSIC
low complexity region	25	37	N/A	INTRINSIC
low complexity region	112	124	N/A	INTRINSIC
Blast:DDHD	125	345	1e-106	BLAST
DDHD	374	578	1.49e-91	SMART
LNS2	723	854	2.12e-55	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142471

Coding Region Coverage

1x: 98.9%
3x: 98.0%
10x: 94.7%
20x: 85.3%

Validation Efficiency

95% (186/196)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of membrane-associated phosphatidylinositol transfer domain-containing proteins. The calcium-binding protein has phosphatidylinositol (PI) transfer activity and interacts with the protein tyrosine kinase PTK2B (also known as PYK2). The protein is homologous to a Drosophila protein that is implicated in the visual transduction pathway in flies. Mutations in this gene result in autosomal dominant cone dystrophy. Multiple transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Sep 2009]

Allele List at MGI

Other mutations in this stock

Total: 91 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9330182L06Rik	A	T	5: 9,422,359	Q352L	probably damaging	Het
Adgrb1	T	C	15: 74,572,156	S96P	probably damaging	Het
Akr1c20	A	G	13: 4,511,293		probably benign	Het
Atp2a3	G	T	11: 72,972,220	V99L	possibly damaging	Het
Atp6v0a1	T	A	11: 101,048,482	I691N	possibly damaging	Het
Atp8b1	C	T	18: 64,561,636	R525Q	probably benign	Het
Aurkb	A	G	11: 69,048,544	D151G	probably damaging	Het
Bank1	A	T	3: 136,066,518		probably benign	Het
Bcl9l	T	C	9: 44,507,406	L847P	probably damaging	Het
Bscl2	T	A	19: 8,847,429	M292K	probably benign	Het
Cacna1c	C	T	6: 118,602,402		probably benign	Het
Cadps2	T	C	6: 23,599,440	K260R	probably benign	Het
Cc2d2a	T	C	5: 43,736,118	S1419P	probably damaging	Het
Ccdc180	G	A	4: 45,914,803	E145K	probably benign	Het
Ccdc58	T	C	16: 36,082,814	S59P	probably damaging	Het
Ccno	C	T	13: 112,988,884		probably benign	Het
Cd300a	A	G	11: 114,893,376	D70G	probably benign	Het
Cenpc1	T	C	5: 86,032,403	D670G	probably benign	Het
Cenpl	A	G	1: 161,085,988	I323V	probably damaging	Het
Cfap44	A	G	16: 44,449,210		probably null	Het
Cfap74	C	T	4: 155,426,115	R386C	probably benign	Het
Cic	T	A	7: 25,287,140	S1299T	probably damaging	Het
Cic	C	A	7: 25,287,141	S1299Y	probably damaging	Het
Clcnkb	T	C	4: 141,412,316	E125G	possibly damaging	Het
Clstn1	G	A	4: 149,634,796	V361M	probably damaging	Het
Coro7	G	A	16: 4,627,504		probably benign	Het
Dchs1	C	T	7: 105,764,983	R875H	probably benign	Het
Eif3j1	A	C	2: 122,052,027	M239L	probably benign	Het
Eif4g3	G	T	4: 138,146,376		probably benign	Het
Erbb4	T	C	1: 68,043,960		probably benign	Het
Erlin2	T	G	8: 27,031,764	V164G	possibly damaging	Het
Fbxo43	G	T	15: 36,161,883	Q393K	probably benign	Het
Fcgr4	A	T	1: 171,025,760	N178I	possibly damaging	Het
Grid2	A	G	6: 64,063,953	N293S	possibly damaging	Het
H2-M1	C	T	17: 36,671,332	V126I	probably benign	Het
Htr1f	T	A	16: 64,926,749	Y60F	probably damaging	Het
Ilf2	A	G	3: 90,481,339		probably null	Het
Impg2	A	T	16: 56,265,049	K931*	probably null	Het
Ints1	T	C	5: 139,751,730	E2176G	probably damaging	Het
Iqsec2	T	C	X: 152,223,403	V1319A	probably benign	Het
Iqsec3	G	T	6: 121,410,724	D685E	probably damaging	Het
Itgbl1	G	A	14: 123,846,546	V279I	probably benign	Het
Kdm4b	C	T	17: 56,393,952	A541V	probably benign	Het
Kif14	A	T	1: 136,468,438	T161S	probably benign	Het
Krt86	T	C	15: 101,479,363		probably benign	Het
Kyat1	C	T	2: 30,187,186		probably null	Het
Limch1	T	C	5: 67,027,539	W791R	probably damaging	Het
Map3k11	T	A	19: 5,695,846	M396K	probably damaging	Het
Mat2a	A	G	6: 72,436,195		probably null	Het
Mbnl2	A	G	14: 120,379,237	I88V	possibly damaging	Het
Mib2	T	C	4: 155,655,673	T708A	probably benign	Het
Mkks	T	C	2: 136,877,606		probably null	Het
Mtss1	T	C	15: 58,944,017	M565V	probably damaging	Het
Myoc	A	G	1: 162,649,035	N436S	probably damaging	Het
Myod1	T	A	7: 46,377,112	V147E	probably damaging	Het
Ngef	A	G	1: 87,509,334	L144P	probably benign	Het
Ngrn	C	T	7: 80,261,930	R92W	probably damaging	Het
Nup153	G	A	13: 46,709,654	T349I	probably benign	Het
Olfr1211	T	A	2: 88,930,283	I11L	probably benign	Het
Olfr600	G	T	7: 103,346,204	S241R	possibly damaging	Het
Pigl	A	G	11: 62,503,748	I135M	probably damaging	Het
Pkhd1	A	T	1: 20,358,917	F2420I	probably damaging	Het
Polr2b	C	T	5: 77,320,076	T119M	probably damaging	Het
Prr29	A	G	11: 106,376,896	Y130C	probably damaging	Het
Rab11fip3	T	C	17: 25,990,999	I1048V	probably damaging	Het
Rab12	G	A	17: 66,500,362	T124I	probably damaging	Het
Rab44	A	G	17: 29,140,307	S490G	probably benign	Het
Rasa3	A	G	8: 13,570,233		probably null	Het
Rhbdl3	C	T	11: 80,353,574	S369L	possibly damaging	Het
Rimbp2	A	T	5: 128,788,356	S643T	probably benign	Het
Rin1	T	G	19: 5,052,652	S396R	probably damaging	Het
Rpusd3	C	T	6: 113,419,237	G28S	probably damaging	Het
Rtl9	T	A	X: 143,100,278	S229T	probably damaging	Het
Rufy1	G	T	11: 50,389,852	T701N	probably benign	Het
Scn4a	A	T	11: 106,320,538	L1551*	probably null	Het
Sec24b	T	C	3: 129,988,984	N1119S	probably null	Het
Serbp1	T	A	6: 67,272,884	*75R	probably null	Het
Setx	C	T	2: 29,179,673	P2497S	probably benign	Het
Slc26a11	A	T	11: 119,359,314	I132F	probably damaging	Het
Slc4a1	A	G	11: 102,352,684	V707A	possibly damaging	Het
Slfn1	A	G	11: 83,121,843	I262V	probably damaging	Het
Tmem168	T	A	6: 13,583,313	D523V	possibly damaging	Het
Traf7	G	T	17: 24,510,551	Q469K	probably benign	Het
Trdmt1	C	A	2: 13,544,617	V6F	probably damaging	Het
Tsacc	A	T	3: 88,287,088		probably benign	Het
Vmn2r5	A	G	3: 64,491,530	I589T	possibly damaging	Het
Vmn2r7	T	C	3: 64,691,039	D699G	probably damaging	Het
Vmn2r82	T	C	10: 79,381,295	V487A	probably damaging	Het
Zfp287	A	T	11: 62,715,029	S351T	probably benign	Het
Zfp651	T	C	9: 121,767,666	V696A	probably damaging	Het
Zfp654	T	C	16: 64,785,688	H176R	possibly damaging	Het

Other mutations in Pitpnm3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01818:Pitpnm3	APN	11	72112251	splice site	probably benign
IGL01871:Pitpnm3	APN	11	72056138	missense	probably damaging	0.99
IGL02058:Pitpnm3	APN	11	72120139	missense	probably benign	0.31
IGL02267:Pitpnm3	APN	11	72071448	missense	probably benign	0.02
IGL02370:Pitpnm3	APN	11	72051858	missense	probably benign	0.04
IGL02613:Pitpnm3	APN	11	72058072	missense	probably damaging	1.00
IGL02835:Pitpnm3	APN	11	72061466	splice site	probably benign
IGL02946:Pitpnm3	APN	11	72092552	missense	probably benign	0.08
IGL02989:Pitpnm3	APN	11	72120186	splice site	probably benign
IGL03173:Pitpnm3	APN	11	72092563	missense	probably benign	0.02
IGL03357:Pitpnm3	APN	11	72070890	nonsense	probably null
Frank	UTSW	11	72070396	missense	probably benign
Mickey	UTSW	11	72070964	missense	probably damaging	1.00
Stuart	UTSW	11	72051929	missense	probably null	0.99
R0102:Pitpnm3	UTSW	11	72056246	missense	probably damaging	1.00
R0964:Pitpnm3	UTSW	11	72058470	missense	probably damaging	1.00
R1475:Pitpnm3	UTSW	11	72074627	missense	probably damaging	1.00
R1566:Pitpnm3	UTSW	11	72058959	splice site	probably null
R1951:Pitpnm3	UTSW	11	72074624	missense	possibly damaging	0.88
R3915:Pitpnm3	UTSW	11	72112284	missense	probably damaging	1.00
R4192:Pitpnm3	UTSW	11	72051959	missense	possibly damaging	0.96
R4278:Pitpnm3	UTSW	11	72074516	missense	probably damaging	1.00
R4928:Pitpnm3	UTSW	11	72063172	missense	probably damaging	1.00
R5543:Pitpnm3	UTSW	11	72056197	missense	probably damaging	0.99
R5626:Pitpnm3	UTSW	11	72112332	missense	probably benign	0.04
R5635:Pitpnm3	UTSW	11	72067160	missense	possibly damaging	0.95
R5958:Pitpnm3	UTSW	11	72112367	splice site	probably null
R6531:Pitpnm3	UTSW	11	72071487	missense	possibly damaging	0.94
R6634:Pitpnm3	UTSW	11	72051929	missense	probably null	0.99
R6764:Pitpnm3	UTSW	11	72051233	missense	probably damaging	1.00
R6912:Pitpnm3	UTSW	11	72070396	missense	probably benign
R7132:Pitpnm3	UTSW	11	72051276	missense	possibly damaging	0.86
R7307:Pitpnm3	UTSW	11	72070964	missense	probably damaging	1.00
R7561:Pitpnm3	UTSW	11	72051182	missense	probably benign	0.02
R7771:Pitpnm3	UTSW	11	72061488	nonsense	probably null
R8099:Pitpnm3	UTSW	11	72070318	missense	possibly damaging	0.85
R8753:Pitpnm3	UTSW	11	72051878	missense	probably benign	0.01
R8817:Pitpnm3	UTSW	11	72051068	missense	possibly damaging	0.74
R8987:Pitpnm3	UTSW	11	72112306	missense	probably damaging	1.00
R9054:Pitpnm3	UTSW	11	72056191	missense	probably damaging	0.97
R9450:Pitpnm3	UTSW	11	72061586	missense	possibly damaging	0.50
R9508:Pitpnm3	UTSW	11	72112295	missense	probably damaging	1.00
R9606:Pitpnm3	UTSW	11	72064243	missense	probably benign	0.02
R9740:Pitpnm3	UTSW	11	72056276	missense	probably benign	0.34
X0018:Pitpnm3	UTSW	11	72071440	missense	probably benign	0.42
X0062:Pitpnm3	UTSW	11	72067108	missense	probably damaging	1.00
Z1186:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1186:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1187:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1188:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1189:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1190:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1191:Pitpnm3	UTSW	11	72120143	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72064129	missense	probably benign
Z1192:Pitpnm3	UTSW	11	72120143	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCTTGAGAGGAAGGCATGATGCTG -3'
(R):5'- AAAGGAAGGTCGTTCCAGGCACTC -3'

Sequencing Primer
(F):5'- CCACTGGAGACATCGACATT -3'
(R):5'- CTAGTGTGTATCTCCCTAGAGAGC -3'

Posted On

2013-04-16