Incidental Mutation 'R2146:Ttc7'
ID233870
Institutional Source Beutler Lab
Gene Symbol Ttc7
Ensembl Gene ENSMUSG00000036918
Gene Nametetratricopeptide repeat domain 7
Synonyms1110035E02Rik, fsn, hea, 1700007L07Rik
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.781) question?
Stock #R2146 (G1)
Quality Score218
Status Validated
Chromosome17
Chromosomal Location87282886-87381769 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to C at 87346707 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000114181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041110] [ENSMUST00000125875] [ENSMUST00000144204] [ENSMUST00000154255]
Predicted Effect probably benign
Transcript: ENSMUST00000041110
SMART Domains Protein: ENSMUSP00000040771
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 8.7e-4 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
TPR 779 812 9.99e1 SMART
TPR 813 846 1.39e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125875
SMART Domains Protein: ENSMUSP00000115351
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Pfam:TPR_9 387 458 1.2e-3 PFAM
Blast:TPR 488 532 7e-20 BLAST
Blast:TPR 534 566 3e-7 BLAST
TPR 567 600 1.11e1 SMART
low complexity region 666 684 N/A INTRINSIC
TPR 711 744 7.89e1 SMART
TPR 745 778 3.87e-2 SMART
low complexity region 787 801 N/A INTRINSIC
low complexity region 806 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000144204
SMART Domains Protein: ENSMUSP00000122563
Gene: ENSMUSG00000036918

DomainStartEndE-ValueType
low complexity region 40 56 N/A INTRINSIC
low complexity region 68 76 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000154255
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeats. Mutations in this gene disrupt intestinal development and can cause early onset inflammatory bowel disease and intestinal atresia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit reduced growth, sparse hair, thickened, scaly skin, increased numbers of splenic B cells, macrophages, and erythroid cells, elevated IgE, glomerulonephritis, and forestomach papillomas. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Ttc7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Ttc7 APN 17 87363564 missense possibly damaging 0.66
IGL00980:Ttc7 APN 17 87321446 missense possibly damaging 0.82
IGL01638:Ttc7 APN 17 87359112 critical splice acceptor site probably null
IGL01896:Ttc7 APN 17 87359124 missense probably damaging 0.99
IGL02643:Ttc7 APN 17 87340899 missense possibly damaging 0.85
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0164:Ttc7 UTSW 17 87379895 missense probably damaging 1.00
R0310:Ttc7 UTSW 17 87361864 missense probably benign 0.00
R0412:Ttc7 UTSW 17 87330044 missense probably benign 0.20
R0520:Ttc7 UTSW 17 87359151 missense possibly damaging 0.93
R1216:Ttc7 UTSW 17 87346578 missense possibly damaging 0.85
R1262:Ttc7 UTSW 17 87340936 missense probably benign 0.09
R1337:Ttc7 UTSW 17 87290296 missense probably damaging 1.00
R1537:Ttc7 UTSW 17 87322463 missense possibly damaging 0.88
R1586:Ttc7 UTSW 17 87361945 critical splice donor site probably null
R1678:Ttc7 UTSW 17 87361901 missense probably damaging 1.00
R1747:Ttc7 UTSW 17 87307015 missense possibly damaging 0.87
R3878:Ttc7 UTSW 17 87370738 intron probably benign
R3934:Ttc7 UTSW 17 87370738 intron probably benign
R4007:Ttc7 UTSW 17 87290251 missense possibly damaging 0.69
R4256:Ttc7 UTSW 17 87321401 critical splice acceptor site probably null
R4671:Ttc7 UTSW 17 87346620 missense probably damaging 1.00
R4676:Ttc7 UTSW 17 87370735 intron probably benign
R4677:Ttc7 UTSW 17 87370735 intron probably benign
R4784:Ttc7 UTSW 17 87340897 missense probably benign 0.03
R4833:Ttc7 UTSW 17 87334321 missense probably damaging 1.00
R4927:Ttc7 UTSW 17 87346705 splice site probably null
R4940:Ttc7 UTSW 17 87306958 missense probably benign 0.02
R5183:Ttc7 UTSW 17 87292878 missense probably damaging 1.00
R5634:Ttc7 UTSW 17 87342087 missense probably benign
R5710:Ttc7 UTSW 17 87290246 missense probably damaging 1.00
R5867:Ttc7 UTSW 17 87322472 missense possibly damaging 0.49
R6437:Ttc7 UTSW 17 87330106 missense probably damaging 1.00
R6982:Ttc7 UTSW 17 87307009 missense probably damaging 1.00
R7299:Ttc7 UTSW 17 87346542 missense possibly damaging 0.68
R7849:Ttc7 UTSW 17 87292946 missense probably null 0.00
R7932:Ttc7 UTSW 17 87292946 missense probably null 0.00
Predicted Primers PCR Primer
(F):5'- TAAGGTCCCTAAACTGGCGGTC -3'
(R):5'- AACAGTTCTCCCCTCTGAGC -3'

Sequencing Primer
(F):5'- AAACTGGCGGTCTCTCCC -3'
(R):5'- TGAGCCCACAGCCTCTATG -3'
Posted On2014-10-01