Incidental Mutation 'R2146:Chsy3'
ID 233871
Institutional Source Beutler Lab
Gene Symbol Chsy3
Ensembl Gene ENSMUSG00000058152
Gene Name chondroitin sulfate synthase 3
Synonyms 4833446K15Rik
MMRRC Submission 040149-MU
Accession Numbers

Ncbi RefSeq: NM_001081328.1; MGI:1926173

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R2146 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 59175401-59410446 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 59176472 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Isoleucine at position 266 (V266I)
Ref Sequence ENSEMBL: ENSMUSP00000079546 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080721]
AlphaFold Q5DTK1
Predicted Effect probably benign
Transcript: ENSMUST00000080721
AA Change: V266I

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000079546
Gene: ENSMUSG00000058152
AA Change: V266I

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 84 96 N/A INTRINSIC
low complexity region 125 144 N/A INTRINSIC
Pfam:Fringe 169 410 9.4e-19 PFAM
Pfam:CHGN 330 866 1.4e-194 PFAM
Pfam:Glyco_tranf_2_2 652 841 1.8e-7 PFAM
Pfam:Glyco_transf_7C 769 839 3.2e-12 PFAM
Meta Mutation Damage Score 0.2420 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CSS3 is a glycosyltransferase that has both glucuronyltransferase and N-acetylgalactosaminyltransferase activities (Yada et al., 2003 [PubMed 12907687]).[supplied by OMIM, Mar 2008]
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
Kif1b T C 4: 149,184,309 K1649R probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Chsy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01472:Chsy3 APN 18 59176367 missense probably damaging 1.00
IGL01543:Chsy3 APN 18 59410400 nonsense probably null
IGL01627:Chsy3 APN 18 59176295 missense probably damaging 1.00
IGL02232:Chsy3 APN 18 59409311 missense possibly damaging 0.89
IGL02604:Chsy3 APN 18 59409115 missense probably benign 0.00
IGL02888:Chsy3 APN 18 59409995 missense probably benign 0.00
IGL03199:Chsy3 APN 18 59176401 missense probably damaging 1.00
bajo UTSW 18 59176166 frame shift probably null
bajo2 UTSW 18 59176419 missense probably damaging 1.00
inferior UTSW 18 59176415 missense probably damaging 1.00
P0045:Chsy3 UTSW 18 59409006 nonsense probably null
R0456:Chsy3 UTSW 18 59176478 missense probably damaging 1.00
R0605:Chsy3 UTSW 18 59409053 missense probably damaging 0.97
R1068:Chsy3 UTSW 18 59410289 missense probably damaging 1.00
R1479:Chsy3 UTSW 18 59408913 missense probably benign 0.09
R1654:Chsy3 UTSW 18 59176416 missense probably damaging 1.00
R1868:Chsy3 UTSW 18 59176488 splice site probably null
R1938:Chsy3 UTSW 18 59409512 missense probably damaging 1.00
R2114:Chsy3 UTSW 18 59179489 missense probably damaging 1.00
R3693:Chsy3 UTSW 18 59176008 missense possibly damaging 0.88
R3787:Chsy3 UTSW 18 59408998 missense probably damaging 1.00
R3811:Chsy3 UTSW 18 59176170 missense probably benign 0.42
R3878:Chsy3 UTSW 18 59409773 missense probably damaging 1.00
R4385:Chsy3 UTSW 18 59176352 missense probably benign 0.00
R4385:Chsy3 UTSW 18 59179474 missense possibly damaging 0.95
R4512:Chsy3 UTSW 18 59410187 missense probably damaging 1.00
R4734:Chsy3 UTSW 18 59179413 missense probably benign 0.07
R4751:Chsy3 UTSW 18 59175800 missense possibly damaging 0.66
R4982:Chsy3 UTSW 18 59409575 missense probably benign 0.07
R4982:Chsy3 UTSW 18 59409767 missense possibly damaging 0.78
R5032:Chsy3 UTSW 18 59179471 missense probably damaging 1.00
R5088:Chsy3 UTSW 18 59179535 missense probably damaging 1.00
R5220:Chsy3 UTSW 18 59410030 missense probably damaging 0.99
R5257:Chsy3 UTSW 18 59409794 missense possibly damaging 0.50
R5259:Chsy3 UTSW 18 59410246 missense probably damaging 0.96
R5558:Chsy3 UTSW 18 59176397 missense probably damaging 1.00
R5872:Chsy3 UTSW 18 59176196 missense probably damaging 1.00
R5990:Chsy3 UTSW 18 59176166 frame shift probably null
R5992:Chsy3 UTSW 18 59176166 frame shift probably null
R6064:Chsy3 UTSW 18 59176166 frame shift probably null
R6065:Chsy3 UTSW 18 59176166 frame shift probably null
R6182:Chsy3 UTSW 18 59179342 missense probably benign 0.00
R6881:Chsy3 UTSW 18 59179408 missense probably damaging 1.00
R6985:Chsy3 UTSW 18 59176488 splice site probably null
R7046:Chsy3 UTSW 18 59409803 missense probably benign 0.00
R7078:Chsy3 UTSW 18 59176077 missense possibly damaging 0.51
R7105:Chsy3 UTSW 18 59176419 missense probably damaging 1.00
R7129:Chsy3 UTSW 18 59410298 missense probably damaging 1.00
R7151:Chsy3 UTSW 18 59409285 missense possibly damaging 0.55
R7224:Chsy3 UTSW 18 59408975 missense probably damaging 1.00
R7860:Chsy3 UTSW 18 59409227 missense probably benign 0.10
R7936:Chsy3 UTSW 18 59409346 missense probably damaging 1.00
R8010:Chsy3 UTSW 18 59410154 missense probably damaging 1.00
R8029:Chsy3 UTSW 18 59179447 missense possibly damaging 0.87
R8215:Chsy3 UTSW 18 59175869 nonsense probably null
R8332:Chsy3 UTSW 18 59409015 missense probably damaging 0.98
R8375:Chsy3 UTSW 18 59179513 missense probably damaging 1.00
R8560:Chsy3 UTSW 18 59410058 missense possibly damaging 0.91
R8700:Chsy3 UTSW 18 59176415 missense probably damaging 1.00
R9040:Chsy3 UTSW 18 59409688 missense probably damaging 0.98
R9290:Chsy3 UTSW 18 59409856 missense probably benign 0.00
R9413:Chsy3 UTSW 18 59176098 missense possibly damaging 0.66
R9490:Chsy3 UTSW 18 59179414 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACAGAAGTACCTGGGCAGTC -3'
(R):5'- TTCAGGCTAAGAATGATGGGC -3'

Sequencing Primer
(F):5'- GTGGAGTTCTTTTCCAGTCAGCAATC -3'
(R):5'- CTAAGAATGATGGGCGGATGC -3'
Posted On 2014-10-01