Incidental Mutation 'R2146:Kif1b'
ID233816
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission 040149-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2146 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149184309 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 1649 (K1649R)
Ref Sequence ENSEMBL: ENSMUSP00000056754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably benign
Transcript: ENSMUST00000055647
AA Change: K1603R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077
AA Change: K1603R

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000060537
AA Change: K1649R

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077
AA Change: K1649R

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Predicted Effect unknown
Transcript: ENSMUST00000139123
AA Change: K327R
SMART Domains Protein: ENSMUSP00000120076
Gene: ENSMUSG00000063077
AA Change: K327R

DomainStartEndE-ValueType
Pfam:DUF3694 1 92 4.4e-23 PFAM
low complexity region 169 186 N/A INTRINSIC
low complexity region 204 232 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
PH 381 480 1.02e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150853
Meta Mutation Damage Score 0.0638 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency 99% (84/85)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 85 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700013D24Rik A T 6: 124,347,844 probably null Het
4933406M09Rik T A 1: 134,390,513 M341K probably damaging Het
9530002B09Rik T A 4: 122,689,405 C13* probably null Het
Abca12 C A 1: 71,263,488 V2191L probably benign Het
Adamts18 G C 8: 113,845,003 A116G possibly damaging Het
Anxa2 TCCC TCC 9: 69,489,754 probably null Het
Arfgef1 C T 1: 10,199,878 A349T probably benign Het
Arhgap6 A G X: 168,796,500 T94A probably benign Het
Arhgef5 T C 6: 43,283,318 S1413P probably damaging Het
Atg4c C A 4: 99,221,226 N143K possibly damaging Het
BC005561 T C 5: 104,518,991 F460L probably benign Het
C1qtnf12 A G 4: 155,966,465 N297S probably benign Het
Cadps2 G T 6: 23,838,999 probably benign Het
Ccdc185 G T 1: 182,747,520 H535N possibly damaging Het
Ccdc57 A G 11: 120,885,225 probably benign Het
Cd163 A G 6: 124,309,208 H239R probably damaging Het
Ceacam2 G T 7: 25,527,943 C166* probably null Het
Ces5a T A 8: 93,534,699 E33D probably benign Het
Chl1 T C 6: 103,715,401 probably null Het
Chsy3 G A 18: 59,176,472 V266I probably benign Het
Cpa5 G T 6: 30,626,822 R251L probably damaging Het
Cps1 A C 1: 67,152,379 probably benign Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cstf1 T C 2: 172,375,763 Y99H probably damaging Het
Cyp2j11 G A 4: 96,316,358 T317I probably damaging Het
Dennd3 C T 15: 73,523,496 T146M probably damaging Het
Dennd3 A T 15: 73,555,060 H762L probably benign Het
Dnah2 T C 11: 69,515,761 M552V probably benign Het
Dnajc22 T C 15: 99,104,383 V303A probably benign Het
Dtx2 T G 5: 136,030,610 L458R probably benign Het
Elmsan1 G T 12: 84,173,035 P382T probably damaging Het
Fat3 A T 9: 15,990,512 F3072L probably benign Het
Fgf5 T C 5: 98,275,550 *265R probably null Het
Fndc11 A G 2: 181,222,125 E241G probably damaging Het
Glb1 T C 9: 114,450,648 Y375H probably damaging Het
Gm4922 T G 10: 18,783,516 Q486P probably benign Het
Gm5786 A T 12: 59,081,298 noncoding transcript Het
Hepacam2 A T 6: 3,463,378 probably benign Het
Ints9 G A 14: 64,986,343 G89R possibly damaging Het
Iqcm T A 8: 75,888,613 W441R probably damaging Het
Itga10 T C 3: 96,651,492 L382P possibly damaging Het
Itga10 G T 3: 96,653,723 G635W probably damaging Het
Kbtbd2 A G 6: 56,779,090 Y554H probably damaging Het
L1cam A T X: 73,861,141 F536Y probably damaging Het
Magee1 A T X: 105,122,958 D783V probably damaging Het
Marveld3 A T 8: 109,959,802 V144E probably benign Het
Mcam T C 9: 44,136,635 V59A probably damaging Het
Mdga2 C T 12: 66,868,741 E47K probably damaging Het
Metrn T A 17: 25,796,627 E38V probably damaging Het
Mfrp T C 9: 44,103,718 L314P probably benign Het
Mospd2 A G X: 164,956,477 probably null Het
Mycbp2 G A 14: 103,155,922 H3068Y probably damaging Het
Myh6 C T 14: 54,953,771 R871H probably damaging Het
Nup214 C T 2: 32,034,466 S1669F probably damaging Het
Olfr1104 T A 2: 87,021,665 N293I probably damaging Het
Olfr1465 T C 19: 13,314,121 T55A probably benign Het
Olfr156 A G 4: 43,821,178 F61S probably damaging Het
Parvb A G 15: 84,232,168 K33E possibly damaging Het
Pdcd11 A G 19: 47,104,752 M490V probably benign Het
Pet2 T C X: 89,406,277 D82G possibly damaging Het
Pkd2 A C 5: 104,455,590 probably benign Het
Reps1 T A 10: 18,093,313 D206E probably benign Het
Rimkla T A 4: 119,474,582 M140L possibly damaging Het
Rnf13 T G 3: 57,802,486 I150S probably null Het
Rxfp4 C T 3: 88,652,893 A84T probably damaging Het
Serpinb8 T A 1: 107,605,927 D237E probably benign Het
Sgo2b T G 8: 63,928,023 T592P probably benign Het
Slc35d1 A T 4: 103,205,152 I228N probably damaging Het
Slc39a1 T G 3: 90,249,450 H104Q probably benign Het
Slc6a6 T C 6: 91,735,180 V230A probably benign Het
Slc9a3 A G 13: 74,121,603 E30G probably benign Het
Slc9c1 A G 16: 45,593,464 Y985C probably benign Het
Supt6 A G 11: 78,230,932 F298S probably damaging Het
Tada2a T C 11: 84,079,629 D432G probably damaging Het
Tmem131 C A 1: 36,812,609 V938L probably benign Het
Tnpo3 A G 6: 29,589,036 V105A probably benign Het
Ttc7 T C 17: 87,346,707 probably benign Het
Ttn T C 2: 76,897,188 probably benign Het
Usp16 T C 16: 87,473,187 probably null Het
Usp36 A G 11: 118,268,665 L486S probably benign Het
Uty T C Y: 1,239,816 I72V probably benign Het
Vps51 A G 19: 6,068,134 V777A probably benign Het
Zfp160 A G 17: 21,026,982 K598R probably benign Het
Zfp39 T C 11: 58,890,332 N535D probably benign Het
Zfp804a A G 2: 82,258,664 T946A probably benign Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7797:Kif1b UTSW 4 149237387 missense probably benign
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7952:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7961:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTTCTGCTTTCTTAGTAGCACATA -3'
(R):5'- AGACGACTTTTGCTGCTCTC -3'

Sequencing Primer
(F):5'- CCACACACTCTAGAGTTGTC -3'
(R):5'- GCCTAGTCTAGCTAACGTTGAGC -3'
Posted On2014-10-01