Mutagenetix > Incidental Mutation

Incidental Mutation 'R2146:Itga10'

233808

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

040149-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R2146 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 96651492 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 382 (L382P)

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

possibly damaging
Transcript: ENSMUST00000029744
AA Change: L382P

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210
AA Change: L382P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000119365
AA Change: L382P

PolyPhen 2 Score 0.590 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210
AA Change: L382P

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.1005

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

99% (84/85)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013D24Rik	A	T	6: 124,347,844		probably null	Het
4933406M09Rik	T	A	1: 134,390,513	M341K	probably damaging	Het
9530002B09Rik	T	A	4: 122,689,405	C13*	probably null	Het
Abca12	C	A	1: 71,263,488	V2191L	probably benign	Het
Adamts18	G	C	8: 113,845,003	A116G	possibly damaging	Het
Anxa2	TCCC	TCC	9: 69,489,754		probably null	Het
Arfgef1	C	T	1: 10,199,878	A349T	probably benign	Het
Arhgap6	A	G	X: 168,796,500	T94A	probably benign	Het
Arhgef5	T	C	6: 43,283,318	S1413P	probably damaging	Het
Atg4c	C	A	4: 99,221,226	N143K	possibly damaging	Het
BC005561	T	C	5: 104,518,991	F460L	probably benign	Het
C1qtnf12	A	G	4: 155,966,465	N297S	probably benign	Het
Cadps2	G	T	6: 23,838,999		probably benign	Het
Ccdc185	G	T	1: 182,747,520	H535N	possibly damaging	Het
Ccdc57	A	G	11: 120,885,225		probably benign	Het
Cd163	A	G	6: 124,309,208	H239R	probably damaging	Het
Ceacam2	G	T	7: 25,527,943	C166*	probably null	Het
Ces5a	T	A	8: 93,534,699	E33D	probably benign	Het
Chl1	T	C	6: 103,715,401		probably null	Het
Chsy3	G	A	18: 59,176,472	V266I	probably benign	Het
Cpa5	G	T	6: 30,626,822	R251L	probably damaging	Het
Cps1	A	C	1: 67,152,379		probably benign	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,741,236		probably null	Het
Cstf1	T	C	2: 172,375,763	Y99H	probably damaging	Het
Cyp2j11	G	A	4: 96,316,358	T317I	probably damaging	Het
Dennd3	C	T	15: 73,523,496	T146M	probably damaging	Het
Dennd3	A	T	15: 73,555,060	H762L	probably benign	Het
Dnah2	T	C	11: 69,515,761	M552V	probably benign	Het
Dnajc22	T	C	15: 99,104,383	V303A	probably benign	Het
Dtx2	T	G	5: 136,030,610	L458R	probably benign	Het
Elmsan1	G	T	12: 84,173,035	P382T	probably damaging	Het
Fat3	A	T	9: 15,990,512	F3072L	probably benign	Het
Fgf5	T	C	5: 98,275,550	*265R	probably null	Het
Fndc11	A	G	2: 181,222,125	E241G	probably damaging	Het
Glb1	T	C	9: 114,450,648	Y375H	probably damaging	Het
Gm4922	T	G	10: 18,783,516	Q486P	probably benign	Het
Gm5786	A	T	12: 59,081,298		noncoding transcript	Het
Hepacam2	A	T	6: 3,463,378		probably benign	Het
Ints9	G	A	14: 64,986,343	G89R	possibly damaging	Het
Iqcm	T	A	8: 75,888,613	W441R	probably damaging	Het
Kbtbd2	A	G	6: 56,779,090	Y554H	probably damaging	Het
Kif1b	T	C	4: 149,184,309	K1649R	probably damaging	Het
L1cam	A	T	X: 73,861,141	F536Y	probably damaging	Het
Magee1	A	T	X: 105,122,958	D783V	probably damaging	Het
Marveld3	A	T	8: 109,959,802	V144E	probably benign	Het
Mcam	T	C	9: 44,136,635	V59A	probably damaging	Het
Mdga2	C	T	12: 66,868,741	E47K	probably damaging	Het
Metrn	T	A	17: 25,796,627	E38V	probably damaging	Het
Mfrp	T	C	9: 44,103,718	L314P	probably benign	Het
Mospd2	A	G	X: 164,956,477		probably null	Het
Mycbp2	G	A	14: 103,155,922	H3068Y	probably damaging	Het
Myh6	C	T	14: 54,953,771	R871H	probably damaging	Het
Nup214	C	T	2: 32,034,466	S1669F	probably damaging	Het
Olfr1104	T	A	2: 87,021,665	N293I	probably damaging	Het
Olfr1465	T	C	19: 13,314,121	T55A	probably benign	Het
Olfr156	A	G	4: 43,821,178	F61S	probably damaging	Het
Parvb	A	G	15: 84,232,168	K33E	possibly damaging	Het
Pdcd11	A	G	19: 47,104,752	M490V	probably benign	Het
Pet2	T	C	X: 89,406,277	D82G	possibly damaging	Het
Pkd2	A	C	5: 104,455,590		probably benign	Het
Reps1	T	A	10: 18,093,313	D206E	probably benign	Het
Rimkla	T	A	4: 119,474,582	M140L	possibly damaging	Het
Rnf13	T	G	3: 57,802,486	I150S	probably null	Het
Rxfp4	C	T	3: 88,652,893	A84T	probably damaging	Het
Serpinb8	T	A	1: 107,605,927	D237E	probably benign	Het
Sgo2b	T	G	8: 63,928,023	T592P	probably benign	Het
Slc35d1	A	T	4: 103,205,152	I228N	probably damaging	Het
Slc39a1	T	G	3: 90,249,450	H104Q	probably benign	Het
Slc6a6	T	C	6: 91,735,180	V230A	probably benign	Het
Slc9a3	A	G	13: 74,121,603	E30G	probably benign	Het
Slc9c1	A	G	16: 45,593,464	Y985C	probably benign	Het
Supt6	A	G	11: 78,230,932	F298S	probably damaging	Het
Tada2a	T	C	11: 84,079,629	D432G	probably damaging	Het
Tmem131	C	A	1: 36,812,609	V938L	probably benign	Het
Tnpo3	A	G	6: 29,589,036	V105A	probably benign	Het
Ttc7	T	C	17: 87,346,707		probably benign	Het
Ttn	T	C	2: 76,897,188		probably benign	Het
Usp16	T	C	16: 87,473,187		probably null	Het
Usp36	A	G	11: 118,268,665	L486S	probably benign	Het
Uty	T	C	Y: 1,239,816	I72V	probably benign	Het
Vps51	A	G	19: 6,068,134	V777A	probably benign	Het
Zfp160	A	G	17: 21,026,982	K598R	probably benign	Het
Zfp39	T	C	11: 58,890,332	N535D	probably benign	Het
Zfp804a	A	G	2: 82,258,664	T946A	probably benign	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6433:Itga10	UTSW	3	96658041	critical splice donor site	probably null
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- AGACATTGTGGATGCACTGGG -3'
(R):5'- AGATGCTCACATACAGGTACACTG -3'

Sequencing Primer
(F):5'- CTTGAAGGTAATGAGTATCCTGGC -3'
(R):5'- TACACTGTGGTCAGAAAGGC -3'

Posted On

2014-10-01