Incidental Mutation 'R2183:Nebl'
ID237271
Institutional Source Beutler Lab
Gene Symbol Nebl
Ensembl Gene ENSMUSG00000053702
Gene Namenebulette
SynonymsLnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik
MMRRC Submission 040185-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2183 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location17343909-17731464 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17404216 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 357 (D357G)
Ref Sequence ENSEMBL: ENSMUSP00000118525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000131957] [ENSMUST00000132418] [ENSMUST00000145492]
Predicted Effect probably benign
Transcript: ENSMUST00000028080
SMART Domains Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
LIM 4 56 6.95e-14 SMART
NEBU 62 92 3.35e-8 SMART
NEBU 98 128 4.88e-10 SMART
NEBU 134 164 3.82e-3 SMART
SH3 213 270 2.12e-20 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000124270
AA Change: D392G

PolyPhen 2 Score 0.955 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702
AA Change: D392G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 1.57e0 SMART
NEBU 280 310 9.67e-1 SMART
NEBU 315 345 6.25e-8 SMART
NEBU 351 381 5.97e-5 SMART
NEBU 387 418 2.56e-4 SMART
NEBU 425 455 8.91e-4 SMART
NEBU 462 492 4.92e-6 SMART
NEBU 499 529 2.33e-7 SMART
NEBU 536 566 1.84e-5 SMART
NEBU 571 601 2.23e-4 SMART
NEBU 602 632 1.24e-2 SMART
NEBU 664 694 6.6e-7 SMART
NEBU 695 725 6.86e-5 SMART
NEBU 726 756 2.03e-7 SMART
NEBU 761 791 1.74e-6 SMART
NEBU 797 827 3.82e-3 SMART
SH3 957 1014 2.12e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124611
SMART Domains Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

DomainStartEndE-ValueType
NEBU 3 33 4.88e-10 SMART
NEBU 39 69 3.82e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000131957
AA Change: D357G

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118525
Gene: ENSMUSG00000053702
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
NEBU 427 457 4.92e-6 SMART
NEBU 464 494 2.33e-7 SMART
NEBU 501 525 1.02e2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000132418
AA Change: D357G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000122024
Gene: ENSMUSG00000053702
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 4.78e-4 SMART
NEBU 427 450 6.81e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145492
AA Change: D357G

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121313
Gene: ENSMUSG00000053702
AA Change: D357G

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
NEBU 30 60 1.21e-5 SMART
NEBU 65 95 5.4e-3 SMART
NEBU 102 132 4.46e-4 SMART
NEBU 139 169 1.31e-1 SMART
NEBU 173 203 5.4e-3 SMART
NEBU 207 237 2.74e-4 SMART
NEBU 245 275 7.35e0 SMART
NEBU 280 310 6.25e-8 SMART
NEBU 316 346 5.97e-5 SMART
NEBU 352 383 2.56e-4 SMART
NEBU 390 420 8.91e-4 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atf7 T C 15: 102,546,473 T287A possibly damaging Het
Atg9b C T 5: 24,390,493 A263T probably benign Het
Cc2d1a A T 8: 84,140,399 H371Q probably damaging Het
Ccdc39 T C 3: 33,821,432 N537S possibly damaging Het
Cdc6 A T 11: 98,908,698 K17* probably null Het
Cenpk T C 13: 104,234,163 M64T probably damaging Het
Dhx57 T A 17: 80,275,331 T282S probably benign Het
Frem1 G A 4: 82,991,495 T757I probably benign Het
Gcsh A T 8: 116,989,146 V66E probably damaging Het
Gdpd1 T C 11: 87,035,276 N281S probably damaging Het
Hs1bp3 T C 12: 8,321,610 V97A possibly damaging Het
Ipo11 T C 13: 106,925,087 T22A probably benign Het
Lama1 A G 17: 67,791,009 N1795D probably damaging Het
Larp4 T C 15: 100,011,897 V627A probably benign Het
Lrp8 T C 4: 107,803,265 C41R probably damaging Het
Mroh2b T A 15: 4,918,225 probably null Het
Mrvi1 A T 7: 110,898,982 L402Q probably damaging Het
Nrg2 T C 18: 36,196,751 K137R probably benign Het
Olfr1086 A T 2: 86,677,036 M99K probably benign Het
Olfr299 T A 7: 86,466,386 V325E probably benign Het
Olfr342 C T 2: 36,527,711 Q100* probably null Het
Phc1 C A 6: 122,323,325 V487L probably damaging Het
Piezo2 A G 18: 63,106,274 V745A probably damaging Het
Proca1 A T 11: 78,204,149 H83L possibly damaging Het
Prpf4 G A 4: 62,411,809 V107I probably damaging Het
Ptprz1 G A 6: 23,002,285 R1458Q probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rbsn C A 6: 92,189,637 L675F probably benign Het
Recql5 T C 11: 115,896,787 S514G probably benign Het
Scai G A 2: 39,080,126 T542I probably benign Het
Sftpa1 G T 14: 41,132,866 D73Y probably damaging Het
Sgms2 A C 3: 131,336,285 probably null Het
Spata7 A T 12: 98,637,612 K47N probably damaging Het
Spg20 A G 3: 55,117,133 I50V probably benign Het
Tbx18 T A 9: 87,705,736 T443S probably damaging Het
Tmem130 T C 5: 144,755,432 D54G possibly damaging Het
Tmem2 G A 19: 21,823,793 R758Q possibly damaging Het
Tnip2 TCTCCT TCT 5: 34,499,613 probably benign Het
Trp53rkb G T 2: 166,793,957 V73L possibly damaging Het
Wwc2 A T 8: 47,842,926 L1103H unknown Het
Yes1 T A 5: 32,645,026 V95E probably damaging Het
Zfp971 T A 2: 178,033,740 H377Q probably damaging Het
Zzef1 C T 11: 72,886,718 R1792* probably null Het
Other mutations in Nebl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02146:Nebl APN 2 17348868 missense probably damaging 0.99
IGL02732:Nebl APN 2 17452484 splice site probably benign
IGL03241:Nebl APN 2 17393164 critical splice donor site probably null
IGL03334:Nebl APN 2 17413711 missense probably damaging 0.98
R0068:Nebl UTSW 2 17434971 nonsense probably null
R0127:Nebl UTSW 2 17392983 missense probably benign 0.31
R0128:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17393023 missense possibly damaging 0.65
R0130:Nebl UTSW 2 17390926 start gained probably benign
R0537:Nebl UTSW 2 17404215 missense possibly damaging 0.62
R0743:Nebl UTSW 2 17411118 missense probably benign
R0884:Nebl UTSW 2 17411118 missense probably benign
R1364:Nebl UTSW 2 17393037 unclassified probably benign
R1638:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R1711:Nebl UTSW 2 17388754 missense probably damaging 0.96
R1933:Nebl UTSW 2 17375292 missense probably damaging 0.97
R1990:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1991:Nebl UTSW 2 17452510 missense probably damaging 0.98
R1992:Nebl UTSW 2 17452510 missense probably damaging 0.98
R2062:Nebl UTSW 2 17397121 missense probably benign 0.39
R2325:Nebl UTSW 2 17393016 missense possibly damaging 0.79
R2679:Nebl UTSW 2 17424591 missense probably benign 0.03
R2877:Nebl UTSW 2 17434929 missense probably damaging 0.99
R2878:Nebl UTSW 2 17434929 missense probably damaging 0.99
R3079:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3080:Nebl UTSW 2 17376651 missense possibly damaging 0.94
R3878:Nebl UTSW 2 17393252 missense possibly damaging 0.83
R3947:Nebl UTSW 2 17378106 critical splice donor site probably null
R4983:Nebl UTSW 2 17375271 missense possibly damaging 0.80
R5006:Nebl UTSW 2 17388771 unclassified probably null
R5256:Nebl UTSW 2 17433975 missense probably benign 0.37
R5491:Nebl UTSW 2 17434972 nonsense probably null
R5533:Nebl UTSW 2 17393268 nonsense probably null
R5597:Nebl UTSW 2 17378167 missense probably benign
R5658:Nebl UTSW 2 17348852 missense probably damaging 1.00
R5933:Nebl UTSW 2 17404187 missense probably benign
R6056:Nebl UTSW 2 17450234 missense probably benign 0.13
R6161:Nebl UTSW 2 17730830 missense probably benign 0.26
R6646:Nebl UTSW 2 17376685 missense probably damaging 1.00
R6784:Nebl UTSW 2 17434914 nonsense probably null
R6935:Nebl UTSW 2 17348826 missense probably damaging 1.00
R7196:Nebl UTSW 2 17452518 missense probably damaging 1.00
R7671:Nebl UTSW 2 17390916 nonsense probably null
R7728:Nebl UTSW 2 17370514 missense
X0012:Nebl UTSW 2 17443794 missense probably benign 0.16
X0025:Nebl UTSW 2 17404267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCAAGGCTCCCTCAGTG -3'
(R):5'- ACATTCAGCATTGGAGGTGC -3'

Sequencing Primer
(F):5'- CCTCAGTGAGGGCCAGAATAAAG -3'
(R):5'- TTTTGGTAGAAGCCTGTAATTGAC -3'
Posted On2014-10-02