Mutagenetix > Incidental Mutations

Incidental Mutation 'R3947:Nebl'

307740

Institutional Source

Beutler Lab

Gene Symbol

Nebl

Ensembl Gene

ENSMUSG00000053702

Gene Name

nebulette

Synonyms

Lnebl, 1200007O21Rik, A630080F05Rik, D830029A09Rik

MMRRC Submission

040927-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R3947 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

17343909-17731464 bp(-) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

A to T at 17378106 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000117805 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028080] [ENSMUST00000124270] [ENSMUST00000177966]

Predicted Effect

probably benign
Transcript: ENSMUST00000028080

SMART Domains

Protein: ENSMUSP00000028080
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
LIM	4	56	6.95e-14	SMART
NEBU	62	92	3.35e-8	SMART
NEBU	98	128	4.88e-10	SMART
NEBU	134	164	3.82e-3	SMART
SH3	213	270	2.12e-20	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000124270

SMART Domains

Protein: ENSMUSP00000117805
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
NEBU	30	60	1.21e-5	SMART
NEBU	65	95	5.4e-3	SMART
NEBU	102	132	4.46e-4	SMART
NEBU	139	169	1.31e-1	SMART
NEBU	173	203	5.4e-3	SMART
NEBU	207	237	2.74e-4	SMART
NEBU	245	275	1.57e0	SMART
NEBU	280	310	9.67e-1	SMART
NEBU	315	345	6.25e-8	SMART
NEBU	351	381	5.97e-5	SMART
NEBU	387	418	2.56e-4	SMART
NEBU	425	455	8.91e-4	SMART
NEBU	462	492	4.92e-6	SMART
NEBU	499	529	2.33e-7	SMART
NEBU	536	566	1.84e-5	SMART
NEBU	571	601	2.23e-4	SMART
NEBU	602	632	1.24e-2	SMART
NEBU	664	694	6.6e-7	SMART
NEBU	695	725	6.86e-5	SMART
NEBU	726	756	2.03e-7	SMART
NEBU	761	791	1.74e-6	SMART
NEBU	797	827	3.82e-3	SMART
SH3	957	1014	2.12e-20	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000124611

SMART Domains

Protein: ENSMUSP00000116065
Gene: ENSMUSG00000053702

Domain	Start	End	E-Value	Type
NEBU	3	33	4.88e-10	SMART
NEBU	39	69	3.82e-3	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127912

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137253

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000150194

Predicted Effect

probably damaging
Transcript: ENSMUST00000177966
AA Change: V120E

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000137567
Gene: ENSMUSG00000053702
AA Change: V120E

Domain	Start	End	E-Value	Type
NEBU	5	35	2.23e-4	SMART
NEBU	36	66	3.28e-2	SMART
NEBU	67	97	6.6e-7	SMART
NEBU	98	120	2e1	SMART

Meta Mutation Damage Score

0.9486

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.4%

Validation Efficiency

97% (32/33)

Allele List at MGI

Other mutations in this stock

Total: 33 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acin1	T	A	14: 54,679,333	Q133L	possibly damaging	Het
Adgrg4	C	T	X: 56,917,754	T1561I	probably benign	Het
Avl9	T	C	6: 56,728,665		probably null	Het
C87436	T	A	6: 86,446,186	H247Q	probably damaging	Het
Cfap43	G	T	19: 47,765,979	H969N	probably benign	Het
Chst15	T	A	7: 132,247,875	N446Y	probably damaging	Het
Col4a3	T	A	1: 82,715,332	I1446N	probably damaging	Het
Disc1	A	G	8: 125,088,135	E246G	probably damaging	Het
Dyrk4	A	G	6: 126,885,305	I408T	probably damaging	Het
Fnbp1l	G	T	3: 122,544,579	A481D	possibly damaging	Het
Gm10608	TACACACACACACACACACACACACACACACACACACACACACACACACACACACA	TACACACACACACACACACACACACACACACACACACACACACACACACA	9: 119,160,662		probably benign	Het
Grk2	G	A	19: 4,292,417	T129M	possibly damaging	Het
Ino80d	G	T	1: 63,074,503	Q263K	probably benign	Het
Iqsec3	A	T	6: 121,387,824	Y835*	probably null	Het
Irak3	T	A	10: 120,170,373	M213L	probably benign	Het
Macf1	T	C	4: 123,380,420	R6388G	probably damaging	Het
Mtnr1a	T	C	8: 45,087,520	Y173H	probably damaging	Het
Myo5b	C	T	18: 74,695,403	R709W	probably damaging	Het
Obscn	T	C	11: 59,131,646	R758G	possibly damaging	Het
Olfr123	A	T	17: 37,796,115	I224L	probably benign	Het
Pex11g	G	A	8: 3,465,787	T82I	probably benign	Het
Pgr	A	G	9: 8,961,452	I842V	probably benign	Het
Pkd1	T	A	17: 24,578,037		probably benign	Het
Rbm20	T	C	19: 53,813,337	I92T	probably benign	Het
Ryr3	C	G	2: 112,675,873	R3443P	probably damaging	Het
Ssh2	A	G	11: 77,398,256	D88G	probably damaging	Het
Suclg2	G	T	6: 95,579,238		probably null	Het
Tdrd3	A	T	14: 87,506,599	D655V	probably damaging	Het
Tex2	C	T	11: 106,520,003	D896N	unknown	Het
Tmem168	C	A	6: 13,583,052	R610L	probably damaging	Het
Ttc17	A	G	2: 94,376,146		probably benign	Het
Vmn2r99	T	C	17: 19,378,990	M312T	probably benign	Het
Wdfy3	T	C	5: 101,870,036	E2546G	probably damaging	Het

Other mutations in Nebl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02146:Nebl	APN	2	17348868	missense	probably damaging	0.99
IGL02732:Nebl	APN	2	17452484	splice site	probably benign
IGL03241:Nebl	APN	2	17393164	critical splice donor site	probably null
IGL03334:Nebl	APN	2	17413711	missense	probably damaging	0.98
R0068:Nebl	UTSW	2	17434971	nonsense	probably null
R0127:Nebl	UTSW	2	17392983	missense	probably benign	0.31
R0128:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17393023	missense	possibly damaging	0.65
R0130:Nebl	UTSW	2	17390926	start gained	probably benign
R0537:Nebl	UTSW	2	17404215	missense	possibly damaging	0.62
R0743:Nebl	UTSW	2	17411118	missense	probably benign
R0884:Nebl	UTSW	2	17411118	missense	probably benign
R1364:Nebl	UTSW	2	17393037	unclassified	probably benign
R1638:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R1711:Nebl	UTSW	2	17388754	missense	probably damaging	0.96
R1933:Nebl	UTSW	2	17375292	missense	probably damaging	0.97
R1990:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1991:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R1992:Nebl	UTSW	2	17452510	missense	probably damaging	0.98
R2062:Nebl	UTSW	2	17397121	missense	probably benign	0.39
R2183:Nebl	UTSW	2	17404216	missense	probably damaging	0.99
R2325:Nebl	UTSW	2	17393016	missense	possibly damaging	0.79
R2679:Nebl	UTSW	2	17424591	missense	probably benign	0.03
R2877:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R2878:Nebl	UTSW	2	17434929	missense	probably damaging	0.99
R3079:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3080:Nebl	UTSW	2	17376651	missense	possibly damaging	0.94
R3878:Nebl	UTSW	2	17393252	missense	possibly damaging	0.83
R4983:Nebl	UTSW	2	17375271	missense	possibly damaging	0.80
R5006:Nebl	UTSW	2	17388771	unclassified	probably null
R5256:Nebl	UTSW	2	17433975	missense	probably benign	0.37
R5491:Nebl	UTSW	2	17434972	nonsense	probably null
R5533:Nebl	UTSW	2	17393268	nonsense	probably null
R5597:Nebl	UTSW	2	17378167	missense	probably benign
R5658:Nebl	UTSW	2	17348852	missense	probably damaging	1.00
R5933:Nebl	UTSW	2	17404187	missense	probably benign
R6056:Nebl	UTSW	2	17450234	missense	probably benign	0.13
R6161:Nebl	UTSW	2	17730830	missense	probably benign	0.26
R6646:Nebl	UTSW	2	17376685	missense	probably damaging	1.00
R6784:Nebl	UTSW	2	17434914	nonsense	probably null
R6935:Nebl	UTSW	2	17348826	missense	probably damaging	1.00
R7196:Nebl	UTSW	2	17452518	missense	probably damaging	1.00
R7671:Nebl	UTSW	2	17390916	nonsense	probably null
R7728:Nebl	UTSW	2	17370514	missense
X0012:Nebl	UTSW	2	17443794	missense	probably benign	0.16
X0025:Nebl	UTSW	2	17404267	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCGCCAGTCAAATGAGACTATC -3'
(R):5'- AACAAGAGTGGATTTGAGTGCC -3'

Sequencing Primer
(F):5'- GGTTCTCAACCCTCATAGTAACATG -3'
(R):5'- TGAGTGCCAGCCTTTGC -3'

Posted On

2015-04-17