Incidental Mutation 'R2255:Wrn'
ID 241950
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 040255-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.323) question?
Stock # R2255 (G1)
Quality Score 138
Status Not validated
Chromosome 8
Chromosomal Location 33234384-33385527 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33329202 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 241 (P241S)
Ref Sequence ENSEMBL: ENSMUSP00000033991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: P241S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: P241S

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: P241S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: P241S

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Predicted Effect probably benign
Transcript: ENSMUST00000211498
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,305,635 T1210I probably benign Het
Agbl1 T C 7: 76,422,184 F581S probably damaging Het
Ambra1 A T 2: 91,917,461 N1061Y probably damaging Het
Arl6ip5 T C 6: 97,232,400 L132S probably damaging Het
Atp10b G A 11: 43,234,380 V1058I probably damaging Het
AU022751 T G X: 6,082,700 E87A probably benign Het
B3gnt4 A C 5: 123,511,279 I236L probably damaging Het
Bmper T A 9: 23,381,463 I356N possibly damaging Het
Bpifa6 T A 2: 153,990,895 I310N probably damaging Het
Btnl9 A T 11: 49,169,316 L535* probably null Het
Capn3 A G 2: 120,501,251 E614G probably benign Het
Catip T C 1: 74,369,000 probably benign Het
Ccdc144b A G 3: 36,019,950 V350A probably benign Het
Ccdc180 T A 4: 45,921,996 S1023R probably damaging Het
Ces2g G A 8: 104,967,414 E461K probably damaging Het
Chad C A 11: 94,565,697 H200Q possibly damaging Het
Crbn C T 6: 106,795,198 probably null Het
Crip3 G C 17: 46,429,372 E33Q probably damaging Het
D130043K22Rik A T 13: 24,856,911 R105S probably damaging Het
Dmxl1 C T 18: 49,846,639 H114Y probably benign Het
Doxl2 G A 6: 48,975,957 R272H possibly damaging Het
Dpp3 T C 19: 4,918,319 N242D probably benign Het
Dtx3l T C 16: 35,936,579 N78S probably benign Het
Dync2h1 A G 9: 6,955,905 probably null Het
Esrp1 A G 4: 11,365,211 V260A probably damaging Het
Etfdh A G 3: 79,604,042 V544A probably benign Het
Fcgr1 G T 3: 96,285,917 H255N possibly damaging Het
Fcrls G T 3: 87,257,348 Y290* probably null Het
Frem2 A G 3: 53,652,514 V1524A probably damaging Het
Gabbr1 T C 17: 37,071,866 I817T probably damaging Het
Gapdhs G C 7: 30,729,908 probably null Het
Gopc A T 10: 52,349,085 I356K probably damaging Het
Gpi1 T C 7: 34,202,877 N471S probably damaging Het
Gpr171 A G 3: 59,098,207 V49A probably benign Het
Greb1l T A 18: 10,554,857 N1634K probably damaging Het
Gria1 G A 11: 57,185,949 R57H probably damaging Het
Herpud1 A G 8: 94,394,613 E344G probably benign Het
Hhip A G 8: 80,045,181 F167L probably damaging Het
Hp1bp3 T A 4: 138,225,898 D84E probably damaging Het
Ier3 A G 17: 35,822,261 Y145C probably damaging Het
Ifi47 A T 11: 49,096,647 I414L probably benign Het
Ifnl2 C T 7: 28,510,213 A50T possibly damaging Het
Jade1 A G 3: 41,591,750 Y70C probably damaging Het
Kif1b A T 4: 149,274,997 F94L probably damaging Het
Krt33a A T 11: 100,014,178 D167E possibly damaging Het
Map1a A G 2: 121,303,791 D1458G possibly damaging Het
Mrgpra4 A G 7: 47,981,775 L26S possibly damaging Het
Mtmr2 T C 9: 13,796,057 Y230H possibly damaging Het
Nae1 T A 8: 104,530,068 D69V probably damaging Het
Nbr1 T A 11: 101,572,817 V625E possibly damaging Het
Nek1 T C 8: 61,089,773 L702P probably damaging Het
Ntf3 T C 6: 126,101,726 *272W probably null Het
Ofcc1 A C 13: 40,094,705 L651R probably damaging Het
Olfm3 A T 3: 115,122,193 probably null Het
Pcdhb19 C T 18: 37,497,944 A264V probably benign Het
Pear1 C A 3: 87,752,186 W780C probably damaging Het
Pkhd1 T A 1: 20,565,639 H489L probably benign Het
Pros1 T A 16: 62,903,572 C228S possibly damaging Het
Rbm10 G A X: 20,635,739 R9H unknown Het
Rwdd1 T C 10: 34,002,470 E123G probably damaging Het
Slc17a2 T C 13: 23,821,008 I412T probably benign Het
Slc22a2 G T 17: 12,599,175 V213F probably damaging Het
Smarca2 A T 19: 26,771,038 I98L probably benign Het
Spag6l T C 16: 16,777,339 E394G probably damaging Het
Spdef T C 17: 27,720,295 T26A probably benign Het
Stk17b T C 1: 53,776,572 I23V probably benign Het
Sult2a7 A G 7: 14,491,893 I56T probably damaging Het
Tango6 T A 8: 106,689,294 probably null Het
Tex46 T C 4: 136,610,533 L12P possibly damaging Het
Ttn T A 2: 76,768,340 M19410L possibly damaging Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Unc5cl T A 17: 48,459,946 I116N possibly damaging Het
Unc80 A T 1: 66,618,258 I1630F possibly damaging Het
Upb1 G A 10: 75,436,217 R288H probably damaging Het
Wdr62 T G 7: 30,267,903 I309L probably damaging Het
Whrn C T 4: 63,418,148 V295M possibly damaging Het
Zer1 G A 2: 30,108,274 L342F probably damaging Het
Zfp687 A T 3: 95,010,437 C675S probably damaging Het
Zfp954 A G 7: 7,115,322 Y408H possibly damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33322377 splice site probably benign
IGL00661:Wrn APN 8 33319145 splice site probably benign
IGL01472:Wrn APN 8 33329172 missense possibly damaging 0.93
IGL01544:Wrn APN 8 33324526 missense probably benign 0.00
IGL01599:Wrn APN 8 33241011 missense possibly damaging 0.69
IGL01688:Wrn APN 8 33310702 splice site probably benign
IGL01916:Wrn APN 8 33257224 missense possibly damaging 0.78
IGL01925:Wrn APN 8 33319180 missense probably benign 0.42
IGL02068:Wrn APN 8 33310749 missense probably benign 0.38
IGL02084:Wrn APN 8 33285179 missense probably benign
IGL02167:Wrn APN 8 33317555 missense probably damaging 1.00
IGL02230:Wrn APN 8 33317563 missense probably damaging 1.00
IGL02717:Wrn APN 8 33343573 missense probably damaging 1.00
IGL02982:Wrn APN 8 33343066 missense probably damaging 1.00
IGL03030:Wrn APN 8 33248961 missense possibly damaging 0.94
IGL03088:Wrn APN 8 33268823 splice site probably benign
IGL03179:Wrn APN 8 33310706 splice site probably null
IGL03306:Wrn APN 8 33336121 missense probably damaging 1.00
R0004:Wrn UTSW 8 33317560 missense probably damaging 1.00
R0190:Wrn UTSW 8 33240983 missense probably benign 0.02
R0441:Wrn UTSW 8 33268750 missense probably benign 0.24
R0463:Wrn UTSW 8 33280815 missense possibly damaging 0.84
R0538:Wrn UTSW 8 33336091 missense probably damaging 0.99
R0682:Wrn UTSW 8 33267820 missense probably benign 0.00
R0729:Wrn UTSW 8 33248918 splice site probably null
R0744:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R0836:Wrn UTSW 8 33295006 missense possibly damaging 0.91
R1168:Wrn UTSW 8 33316408 missense probably damaging 1.00
R1301:Wrn UTSW 8 33292686 missense probably damaging 1.00
R1352:Wrn UTSW 8 33294916 missense probably benign 0.25
R1396:Wrn UTSW 8 33268819 missense probably damaging 1.00
R1432:Wrn UTSW 8 33319141 splice site probably benign
R1523:Wrn UTSW 8 33292716 missense probably benign 0.23
R1625:Wrn UTSW 8 33329130 missense probably benign 0.01
R1664:Wrn UTSW 8 33280766 splice site probably null
R1773:Wrn UTSW 8 33343561 missense probably damaging 1.00
R1864:Wrn UTSW 8 33288864 missense probably damaging 0.99
R1868:Wrn UTSW 8 33257221 missense probably benign 0.03
R2011:Wrn UTSW 8 33236404 missense probably benign 0.02
R2075:Wrn UTSW 8 33322329 missense probably benign 0.00
R2091:Wrn UTSW 8 33267825 missense probably benign
R2213:Wrn UTSW 8 33257015 missense probably benign 0.05
R2276:Wrn UTSW 8 33324556 missense probably benign 0.02
R3177:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3277:Wrn UTSW 8 33317554 missense probably damaging 1.00
R3779:Wrn UTSW 8 33241020 missense probably damaging 1.00
R3827:Wrn UTSW 8 33324520 missense probably benign 0.00
R4111:Wrn UTSW 8 33352155 missense probably benign 0.02
R4392:Wrn UTSW 8 33251832 missense probably damaging 0.99
R4458:Wrn UTSW 8 33294998 missense probably damaging 0.99
R4650:Wrn UTSW 8 33255509 missense probably benign 0.05
R4656:Wrn UTSW 8 33335991 splice site probably null
R4657:Wrn UTSW 8 33335991 splice site probably null
R4667:Wrn UTSW 8 33324338 missense probably benign 0.00
R4735:Wrn UTSW 8 33285222 missense probably damaging 1.00
R4933:Wrn UTSW 8 33322343 missense probably benign 0.01
R5104:Wrn UTSW 8 33267867 splice site probably null
R5166:Wrn UTSW 8 33352072 critical splice donor site probably null
R5279:Wrn UTSW 8 33241101 missense probably damaging 1.00
R5400:Wrn UTSW 8 33294917 missense probably benign 0.02
R5575:Wrn UTSW 8 33336130 missense probably benign 0.02
R5695:Wrn UTSW 8 33324318 missense probably benign 0.26
R5729:Wrn UTSW 8 33268778 missense probably benign 0.02
R6044:Wrn UTSW 8 33236429 missense probably damaging 1.00
R6139:Wrn UTSW 8 33353332 missense probably damaging 1.00
R6158:Wrn UTSW 8 33319172 missense probably damaging 1.00
R6192:Wrn UTSW 8 33284654 missense probably benign 0.12
R6243:Wrn UTSW 8 33284654 missense possibly damaging 0.94
R6354:Wrn UTSW 8 33343638 missense possibly damaging 0.93
R6429:Wrn UTSW 8 33342996 missense probably damaging 1.00
R6490:Wrn UTSW 8 33319220 missense probably benign 0.01
R6529:Wrn UTSW 8 33335976 splice site probably null
R6535:Wrn UTSW 8 33336103 missense probably damaging 0.99
R7001:Wrn UTSW 8 33352129 missense probably benign 0.04
R7114:Wrn UTSW 8 33285121 frame shift probably null
R7198:Wrn UTSW 8 33324318 missense probably benign 0.00
R7200:Wrn UTSW 8 33322348 missense probably benign 0.00
R7227:Wrn UTSW 8 33248946 missense probably damaging 1.00
R7299:Wrn UTSW 8 33292718 missense probably damaging 1.00
R7374:Wrn UTSW 8 33268911 missense probably damaging 1.00
R7402:Wrn UTSW 8 33248966 missense probably benign 0.00
R7404:Wrn UTSW 8 33248966 missense probably benign 0.00
R7405:Wrn UTSW 8 33248966 missense probably benign 0.00
R7464:Wrn UTSW 8 33335996 critical splice donor site probably null
R7474:Wrn UTSW 8 33329181 missense probably damaging 0.96
R7609:Wrn UTSW 8 33310713 missense possibly damaging 0.50
R7729:Wrn UTSW 8 33324426 missense probably benign 0.21
R7830:Wrn UTSW 8 33269054 missense probably damaging 0.97
R7998:Wrn UTSW 8 33292643 missense probably benign 0.10
R8239:Wrn UTSW 8 33329185 missense probably damaging 1.00
R8262:Wrn UTSW 8 33324246 missense probably benign 0.07
R8410:Wrn UTSW 8 33269020 missense probably damaging 1.00
R8480:Wrn UTSW 8 33288768 missense probably benign 0.10
R8530:Wrn UTSW 8 33280824 missense possibly damaging 0.83
R8540:Wrn UTSW 8 33352126 missense probably damaging 0.96
R8708:Wrn UTSW 8 33292643 missense probably damaging 0.96
R8783:Wrn UTSW 8 33336013 missense probably null 1.00
R8870:Wrn UTSW 8 33329192 missense probably benign 0.01
R8876:Wrn UTSW 8 33324394 missense probably benign 0.00
R9050:Wrn UTSW 8 33342993 missense probably damaging 1.00
R9329:Wrn UTSW 8 33240978 missense probably benign
R9595:Wrn UTSW 8 33268933 missense probably benign
R9621:Wrn UTSW 8 33324273 missense probably benign 0.01
R9623:Wrn UTSW 8 33284616 critical splice donor site probably null
RF010:Wrn UTSW 8 33288765 missense probably benign 0.13
X0017:Wrn UTSW 8 33280782 missense probably damaging 1.00
Z1176:Wrn UTSW 8 33334209 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGTGATTGAACGTGCATAC -3'
(R):5'- AGAGGGAAGTGTTCTGTTAGAATTC -3'

Sequencing Primer
(F):5'- AACCTCTGGAGAGTTTCC -3'
(R):5'- CATTGTGCGAATAGATGAAAATCTGG -3'
Posted On 2014-10-16