Incidental Mutation 'R2255:Wrn'
ID 241950
Institutional Source Beutler Lab
Gene Symbol Wrn
Ensembl Gene ENSMUSG00000031583
Gene Name Werner syndrome RecQ like helicase
Synonyms
MMRRC Submission 040255-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.366) question?
Stock # R2255 (G1)
Quality Score 138
Status Not validated
Chromosome 8
Chromosomal Location 33724412-33875555 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 33819230 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 241 (P241S)
Ref Sequence ENSEMBL: ENSMUSP00000033991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033990] [ENSMUST00000033991] [ENSMUST00000211498]
AlphaFold O09053
Predicted Effect probably benign
Transcript: ENSMUST00000033990
AA Change: P241S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033990
Gene: ENSMUSG00000031583
AA Change: P241S

DomainStartEndE-ValueType
35EXOc 47 226 1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.3e-28 SMART
HELICc 743 824 3.7e-27 SMART
RQC 923 1028 3.1e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1222 1318 2.7e-9 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000033991
AA Change: P241S

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000033991
Gene: ENSMUSG00000031583
AA Change: P241S

DomainStartEndE-ValueType
35EXOc 47 226 1.1e-47 SMART
low complexity region 484 489 N/A INTRINSIC
DEXDc 509 704 2.4e-28 SMART
HELICc 743 824 3.7e-27 SMART
Pfam:RecQ_Zn_bind 835 905 2.2e-8 PFAM
RQC 923 1028 3.2e-28 SMART
HRDC 1115 1194 1.5e-26 SMART
low complexity region 1205 1216 N/A INTRINSIC
Pfam:HTH_40 1223 1317 4.3e-10 PFAM
low complexity region 1342 1356 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209293
Predicted Effect probably benign
Transcript: ENSMUST00000211498
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the RecQ subfamily and the DEAH (Asp-Glu-Ala-His) subfamily of DNA and RNA helicases. DNA helicases are involved in many aspects of DNA metabolism, including transcription, replication, recombination, and repair. This protein contains a nuclear localization signal in the C-terminus and shows a predominant nucleolar localization. It possesses an intrinsic 3' to 5' DNA helicase activity, and is also a 3' to 5' exonuclease. Based on interactions between this protein and Ku70/80 heterodimer in DNA end processing, this protein may be involved in the repair of double strand DNA breaks. Defects in this gene are the cause of Werner syndrome, an autosomal recessive disorder characterized by premature aging. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants show enhanced frequency and variety of tumors in conjunction with Trp53 knockout alleles. Homozygotes also have an elevated frequency of somatic reversion of the pink-eyed dilution unstable mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 G A 17: 46,616,561 (GRCm39) T1210I probably benign Het
Agbl1 T C 7: 76,071,932 (GRCm39) F581S probably damaging Het
Ambra1 A T 2: 91,747,806 (GRCm39) N1061Y probably damaging Het
Aoc1l1 G A 6: 48,952,891 (GRCm39) R272H possibly damaging Het
Arl6ip5 T C 6: 97,209,361 (GRCm39) L132S probably damaging Het
Atp10b G A 11: 43,125,207 (GRCm39) V1058I probably damaging Het
B3gnt4 A C 5: 123,649,342 (GRCm39) I236L probably damaging Het
Bmper T A 9: 23,292,759 (GRCm39) I356N possibly damaging Het
Bpifa6 T A 2: 153,832,815 (GRCm39) I310N probably damaging Het
Btnl9 A T 11: 49,060,143 (GRCm39) L535* probably null Het
Capn3 A G 2: 120,331,732 (GRCm39) E614G probably benign Het
Catip T C 1: 74,408,159 (GRCm39) probably benign Het
Ccdc180 T A 4: 45,921,996 (GRCm39) S1023R probably damaging Het
Ces2g G A 8: 105,694,046 (GRCm39) E461K probably damaging Het
Chad C A 11: 94,456,523 (GRCm39) H200Q possibly damaging Het
Crbn C T 6: 106,772,159 (GRCm39) probably null Het
Crip3 G C 17: 46,740,298 (GRCm39) E33Q probably damaging Het
D130043K22Rik A T 13: 25,040,894 (GRCm39) R105S probably damaging Het
Dmxl1 C T 18: 49,979,706 (GRCm39) H114Y probably benign Het
Dpp3 T C 19: 4,968,347 (GRCm39) N242D probably benign Het
Dtx3l T C 16: 35,756,949 (GRCm39) N78S probably benign Het
Dync2h1 A G 9: 6,955,905 (GRCm39) probably null Het
Esrp1 A G 4: 11,365,211 (GRCm39) V260A probably damaging Het
Etfdh A G 3: 79,511,349 (GRCm39) V544A probably benign Het
Ezhip T G X: 5,994,754 (GRCm39) E87A probably benign Het
Fcgr1 G T 3: 96,193,233 (GRCm39) H255N possibly damaging Het
Fcrl2 G T 3: 87,164,655 (GRCm39) Y290* probably null Het
Frem2 A G 3: 53,559,935 (GRCm39) V1524A probably damaging Het
Gabbr1 T C 17: 37,382,758 (GRCm39) I817T probably damaging Het
Gapdhs G C 7: 30,429,333 (GRCm39) probably null Het
Gm57858 A G 3: 36,074,099 (GRCm39) V350A probably benign Het
Gopc A T 10: 52,225,181 (GRCm39) I356K probably damaging Het
Gpi1 T C 7: 33,902,302 (GRCm39) N471S probably damaging Het
Gpr171 A G 3: 59,005,628 (GRCm39) V49A probably benign Het
Greb1l T A 18: 10,554,857 (GRCm39) N1634K probably damaging Het
Gria1 G A 11: 57,076,775 (GRCm39) R57H probably damaging Het
Herpud1 A G 8: 95,121,241 (GRCm39) E344G probably benign Het
Hhip A G 8: 80,771,810 (GRCm39) F167L probably damaging Het
Hp1bp3 T A 4: 137,953,209 (GRCm39) D84E probably damaging Het
Ier3 A G 17: 36,133,153 (GRCm39) Y145C probably damaging Het
Ifi47 A T 11: 48,987,474 (GRCm39) I414L probably benign Het
Ifnl2 C T 7: 28,209,638 (GRCm39) A50T possibly damaging Het
Jade1 A G 3: 41,546,185 (GRCm39) Y70C probably damaging Het
Kif1b A T 4: 149,359,454 (GRCm39) F94L probably damaging Het
Krt33a A T 11: 99,905,004 (GRCm39) D167E possibly damaging Het
Map1a A G 2: 121,134,272 (GRCm39) D1458G possibly damaging Het
Mrgpra4 A G 7: 47,631,523 (GRCm39) L26S possibly damaging Het
Mtmr2 T C 9: 13,707,353 (GRCm39) Y230H possibly damaging Het
Nae1 T A 8: 105,256,700 (GRCm39) D69V probably damaging Het
Nbr1 T A 11: 101,463,643 (GRCm39) V625E possibly damaging Het
Nek1 T C 8: 61,542,807 (GRCm39) L702P probably damaging Het
Ntf3 T C 6: 126,078,689 (GRCm39) *272W probably null Het
Ofcc1 A C 13: 40,248,181 (GRCm39) L651R probably damaging Het
Olfm3 A T 3: 114,915,842 (GRCm39) probably null Het
Pcdhb19 C T 18: 37,630,997 (GRCm39) A264V probably benign Het
Pear1 C A 3: 87,659,493 (GRCm39) W780C probably damaging Het
Pkhd1 T A 1: 20,635,863 (GRCm39) H489L probably benign Het
Pros1 T A 16: 62,723,935 (GRCm39) C228S possibly damaging Het
Rbm10 G A X: 20,501,978 (GRCm39) R9H unknown Het
Rwdd1 T C 10: 33,878,466 (GRCm39) E123G probably damaging Het
Slc22a2 G T 17: 12,818,062 (GRCm39) V213F probably damaging Het
Slc34a1 T C 13: 24,004,991 (GRCm39) I412T probably benign Het
Smarca2 A T 19: 26,748,438 (GRCm39) I98L probably benign Het
Spag6l T C 16: 16,595,203 (GRCm39) E394G probably damaging Het
Spdef T C 17: 27,939,269 (GRCm39) T26A probably benign Het
Stk17b T C 1: 53,815,731 (GRCm39) I23V probably benign Het
Sult2a7 A G 7: 14,225,818 (GRCm39) I56T probably damaging Het
Tango6 T A 8: 107,415,926 (GRCm39) probably null Het
Tex46 T C 4: 136,337,844 (GRCm39) L12P possibly damaging Het
Ttn T A 2: 76,598,684 (GRCm39) M19410L possibly damaging Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Unc5cl T A 17: 48,766,974 (GRCm39) I116N possibly damaging Het
Unc80 A T 1: 66,657,417 (GRCm39) I1630F possibly damaging Het
Upb1 G A 10: 75,272,051 (GRCm39) R288H probably damaging Het
Wdr62 T G 7: 29,967,328 (GRCm39) I309L probably damaging Het
Whrn C T 4: 63,336,385 (GRCm39) V295M possibly damaging Het
Zer1 G A 2: 29,998,286 (GRCm39) L342F probably damaging Het
Zfp687 A T 3: 94,917,748 (GRCm39) C675S probably damaging Het
Zfp954 A G 7: 7,118,321 (GRCm39) Y408H possibly damaging Het
Other mutations in Wrn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00659:Wrn APN 8 33,812,405 (GRCm39) splice site probably benign
IGL00661:Wrn APN 8 33,809,173 (GRCm39) splice site probably benign
IGL01472:Wrn APN 8 33,819,200 (GRCm39) missense possibly damaging 0.93
IGL01544:Wrn APN 8 33,814,554 (GRCm39) missense probably benign 0.00
IGL01599:Wrn APN 8 33,731,039 (GRCm39) missense possibly damaging 0.69
IGL01688:Wrn APN 8 33,800,730 (GRCm39) splice site probably benign
IGL01916:Wrn APN 8 33,747,252 (GRCm39) missense possibly damaging 0.78
IGL01925:Wrn APN 8 33,809,208 (GRCm39) missense probably benign 0.42
IGL02068:Wrn APN 8 33,800,777 (GRCm39) missense probably benign 0.38
IGL02084:Wrn APN 8 33,775,207 (GRCm39) missense probably benign
IGL02167:Wrn APN 8 33,807,583 (GRCm39) missense probably damaging 1.00
IGL02230:Wrn APN 8 33,807,591 (GRCm39) missense probably damaging 1.00
IGL02717:Wrn APN 8 33,833,601 (GRCm39) missense probably damaging 1.00
IGL02982:Wrn APN 8 33,833,094 (GRCm39) missense probably damaging 1.00
IGL03030:Wrn APN 8 33,738,989 (GRCm39) missense possibly damaging 0.94
IGL03088:Wrn APN 8 33,758,851 (GRCm39) splice site probably benign
IGL03179:Wrn APN 8 33,800,734 (GRCm39) splice site probably null
IGL03306:Wrn APN 8 33,826,149 (GRCm39) missense probably damaging 1.00
R0004:Wrn UTSW 8 33,807,588 (GRCm39) missense probably damaging 1.00
R0190:Wrn UTSW 8 33,731,011 (GRCm39) missense probably benign 0.02
R0441:Wrn UTSW 8 33,758,778 (GRCm39) missense probably benign 0.24
R0463:Wrn UTSW 8 33,770,843 (GRCm39) missense possibly damaging 0.84
R0538:Wrn UTSW 8 33,826,119 (GRCm39) missense probably damaging 0.99
R0682:Wrn UTSW 8 33,757,848 (GRCm39) missense probably benign 0.00
R0729:Wrn UTSW 8 33,738,946 (GRCm39) splice site probably null
R0744:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R0836:Wrn UTSW 8 33,785,034 (GRCm39) missense possibly damaging 0.91
R1168:Wrn UTSW 8 33,806,436 (GRCm39) missense probably damaging 1.00
R1301:Wrn UTSW 8 33,782,714 (GRCm39) missense probably damaging 1.00
R1352:Wrn UTSW 8 33,784,944 (GRCm39) missense probably benign 0.25
R1396:Wrn UTSW 8 33,758,847 (GRCm39) missense probably damaging 1.00
R1432:Wrn UTSW 8 33,809,169 (GRCm39) splice site probably benign
R1523:Wrn UTSW 8 33,782,744 (GRCm39) missense probably benign 0.23
R1625:Wrn UTSW 8 33,819,158 (GRCm39) missense probably benign 0.01
R1664:Wrn UTSW 8 33,770,794 (GRCm39) splice site probably null
R1773:Wrn UTSW 8 33,833,589 (GRCm39) missense probably damaging 1.00
R1864:Wrn UTSW 8 33,778,892 (GRCm39) missense probably damaging 0.99
R1868:Wrn UTSW 8 33,747,249 (GRCm39) missense probably benign 0.03
R2011:Wrn UTSW 8 33,726,432 (GRCm39) missense probably benign 0.02
R2075:Wrn UTSW 8 33,812,357 (GRCm39) missense probably benign 0.00
R2091:Wrn UTSW 8 33,757,853 (GRCm39) missense probably benign
R2213:Wrn UTSW 8 33,747,043 (GRCm39) missense probably benign 0.05
R2276:Wrn UTSW 8 33,814,584 (GRCm39) missense probably benign 0.02
R3177:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3277:Wrn UTSW 8 33,807,582 (GRCm39) missense probably damaging 1.00
R3779:Wrn UTSW 8 33,731,048 (GRCm39) missense probably damaging 1.00
R3827:Wrn UTSW 8 33,814,548 (GRCm39) missense probably benign 0.00
R4111:Wrn UTSW 8 33,842,183 (GRCm39) missense probably benign 0.02
R4392:Wrn UTSW 8 33,741,860 (GRCm39) missense probably damaging 0.99
R4458:Wrn UTSW 8 33,785,026 (GRCm39) missense probably damaging 0.99
R4650:Wrn UTSW 8 33,745,537 (GRCm39) missense probably benign 0.05
R4656:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4657:Wrn UTSW 8 33,826,019 (GRCm39) splice site probably null
R4667:Wrn UTSW 8 33,814,366 (GRCm39) missense probably benign 0.00
R4735:Wrn UTSW 8 33,775,250 (GRCm39) missense probably damaging 1.00
R4933:Wrn UTSW 8 33,812,371 (GRCm39) missense probably benign 0.01
R5104:Wrn UTSW 8 33,757,895 (GRCm39) splice site probably null
R5166:Wrn UTSW 8 33,842,100 (GRCm39) critical splice donor site probably null
R5279:Wrn UTSW 8 33,731,129 (GRCm39) missense probably damaging 1.00
R5400:Wrn UTSW 8 33,784,945 (GRCm39) missense probably benign 0.02
R5575:Wrn UTSW 8 33,826,158 (GRCm39) missense probably benign 0.02
R5695:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.26
R5729:Wrn UTSW 8 33,758,806 (GRCm39) missense probably benign 0.02
R6044:Wrn UTSW 8 33,726,457 (GRCm39) missense probably damaging 1.00
R6139:Wrn UTSW 8 33,843,360 (GRCm39) missense probably damaging 1.00
R6158:Wrn UTSW 8 33,809,200 (GRCm39) missense probably damaging 1.00
R6192:Wrn UTSW 8 33,774,682 (GRCm39) missense probably benign 0.12
R6243:Wrn UTSW 8 33,774,682 (GRCm39) missense possibly damaging 0.94
R6354:Wrn UTSW 8 33,833,666 (GRCm39) missense possibly damaging 0.93
R6429:Wrn UTSW 8 33,833,024 (GRCm39) missense probably damaging 1.00
R6490:Wrn UTSW 8 33,809,248 (GRCm39) missense probably benign 0.01
R6529:Wrn UTSW 8 33,826,004 (GRCm39) splice site probably null
R6535:Wrn UTSW 8 33,826,131 (GRCm39) missense probably damaging 0.99
R7001:Wrn UTSW 8 33,842,157 (GRCm39) missense probably benign 0.04
R7114:Wrn UTSW 8 33,775,149 (GRCm39) frame shift probably null
R7198:Wrn UTSW 8 33,814,346 (GRCm39) missense probably benign 0.00
R7200:Wrn UTSW 8 33,812,376 (GRCm39) missense probably benign 0.00
R7227:Wrn UTSW 8 33,738,974 (GRCm39) missense probably damaging 1.00
R7299:Wrn UTSW 8 33,782,746 (GRCm39) missense probably damaging 1.00
R7374:Wrn UTSW 8 33,758,939 (GRCm39) missense probably damaging 1.00
R7402:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7404:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7405:Wrn UTSW 8 33,738,994 (GRCm39) missense probably benign 0.00
R7464:Wrn UTSW 8 33,826,024 (GRCm39) critical splice donor site probably null
R7474:Wrn UTSW 8 33,819,209 (GRCm39) missense probably damaging 0.96
R7609:Wrn UTSW 8 33,800,741 (GRCm39) missense possibly damaging 0.50
R7729:Wrn UTSW 8 33,814,454 (GRCm39) missense probably benign 0.21
R7830:Wrn UTSW 8 33,759,082 (GRCm39) missense probably damaging 0.97
R7998:Wrn UTSW 8 33,782,671 (GRCm39) missense probably benign 0.10
R8239:Wrn UTSW 8 33,819,213 (GRCm39) missense probably damaging 1.00
R8262:Wrn UTSW 8 33,814,274 (GRCm39) missense probably benign 0.07
R8410:Wrn UTSW 8 33,759,048 (GRCm39) missense probably damaging 1.00
R8480:Wrn UTSW 8 33,778,796 (GRCm39) missense probably benign 0.10
R8530:Wrn UTSW 8 33,770,852 (GRCm39) missense possibly damaging 0.83
R8540:Wrn UTSW 8 33,842,154 (GRCm39) missense probably damaging 0.96
R8708:Wrn UTSW 8 33,782,671 (GRCm39) missense probably damaging 0.96
R8783:Wrn UTSW 8 33,826,041 (GRCm39) missense probably null 1.00
R8870:Wrn UTSW 8 33,819,220 (GRCm39) missense probably benign 0.01
R8876:Wrn UTSW 8 33,814,422 (GRCm39) missense probably benign 0.00
R9050:Wrn UTSW 8 33,833,021 (GRCm39) missense probably damaging 1.00
R9329:Wrn UTSW 8 33,731,006 (GRCm39) missense probably benign
R9595:Wrn UTSW 8 33,758,961 (GRCm39) missense probably benign
R9621:Wrn UTSW 8 33,814,301 (GRCm39) missense probably benign 0.01
R9623:Wrn UTSW 8 33,774,644 (GRCm39) critical splice donor site probably null
R9797:Wrn UTSW 8 33,758,950 (GRCm39) missense probably benign 0.02
RF010:Wrn UTSW 8 33,778,793 (GRCm39) missense probably benign 0.13
X0017:Wrn UTSW 8 33,770,810 (GRCm39) missense probably damaging 1.00
Z1176:Wrn UTSW 8 33,824,237 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AAAGGTGATTGAACGTGCATAC -3'
(R):5'- AGAGGGAAGTGTTCTGTTAGAATTC -3'

Sequencing Primer
(F):5'- AACCTCTGGAGAGTTTCC -3'
(R):5'- CATTGTGCGAATAGATGAAAATCTGG -3'
Posted On 2014-10-16