Incidental Mutation 'R2292:Fkbp4'
ID245031
Institutional Source Beutler Lab
Gene Symbol Fkbp4
Ensembl Gene ENSMUSG00000030357
Gene NameFK506 binding protein 4
SynonymsFKBP52, FKBP-52
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.795) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location128429735-128438677 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 128436662 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 6 (V6G)
Ref Sequence ENSEMBL: ENSMUSP00000122087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032508] [ENSMUST00000150387] [ENSMUST00000151796]
Predicted Effect probably damaging
Transcript: ENSMUST00000032508
AA Change: V53G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032508
Gene: ENSMUSG00000030357
AA Change: V53G

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 2.6e-33 PFAM
Pfam:FKBP_C 160 250 1.3e-14 PFAM
TPR 270 303 4.44e1 SMART
TPR 319 352 1.76e-5 SMART
TPR 353 386 2e-4 SMART
low complexity region 419 431 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139448
SMART Domains Protein: ENSMUSP00000114939
Gene: ENSMUSG00000030357

DomainStartEndE-ValueType
Pfam:FKBP_C 43 135 3.8e-33 PFAM
Pfam:FKBP_C 160 250 2.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144745
Predicted Effect probably damaging
Transcript: ENSMUST00000150387
AA Change: V6G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000119930
Gene: ENSMUSG00000030357
AA Change: V6G

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 7.8e-31 PFAM
Pfam:FKBP_C 113 203 4.7e-13 PFAM
Blast:TPR 223 256 3e-14 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000151796
AA Change: V6G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122087
Gene: ENSMUSG00000030357
AA Change: V6G

DomainStartEndE-ValueType
Pfam:FKBP_C 1 88 3.7e-31 PFAM
Pfam:FKBP_C 113 187 3.2e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204081
Meta Mutation Damage Score 0.9117 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. This encoded protein is a cis-trans prolyl isomerase that binds to the immunosuppressants FK506 and rapamycin. It has high structural and functional similarity to FK506-binding protein 1A (FKBP1A), but unlike FKBP1A, this protein does not have immunosuppressant activity when complexed with FK506. It interacts with interferon regulatory factor-4 and plays an important role in immunoregulatory gene expression in B and T lymphocytes. This encoded protein is known to associate with phytanoyl-CoA alpha-hydroxylase. It can also associate with two heat shock proteins (hsp90 and hsp70) and thus may play a role in the intracellular trafficking of hetero-oligomeric forms of the steroid hormone receptors. This protein correlates strongly with adeno-associated virus type 2 vectors (AAV) resulting in a significant increase in AAV-mediated transgene expression in human cell lines. Thus this encoded protein is thought to have important implications for the optimal use of AAV vectors in human gene therapy. The human genome contains several non-transcribed pseudogenes similar to this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Homozygous null males show reproductive tissue defects consistent with androgen insensitivity such as ambiguous external genitalia, dysgenic prostate, malformed seminal gland and cryptorchism. Males also exhibit hypospadia and infertility. Females are sterile due to failure of implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Fkbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01151:Fkbp4 APN 6 128435791 missense probably benign 0.28
IGL02215:Fkbp4 APN 6 128434470 splice site probably benign
IGL02607:Fkbp4 APN 6 128434470 splice site probably benign
IGL03186:Fkbp4 APN 6 128434800 missense probably benign
IGL03238:Fkbp4 APN 6 128434757 missense probably damaging 1.00
R0083:Fkbp4 UTSW 6 128432407 unclassified probably benign
R0491:Fkbp4 UTSW 6 128435742 missense probably damaging 1.00
R1652:Fkbp4 UTSW 6 128436674 missense probably damaging 0.97
R1868:Fkbp4 UTSW 6 128432490 missense probably benign 0.00
R2010:Fkbp4 UTSW 6 128435802 missense probably benign 0.01
R5616:Fkbp4 UTSW 6 128433554 missense probably damaging 0.99
R6478:Fkbp4 UTSW 6 128433231 missense probably damaging 1.00
R7156:Fkbp4 UTSW 6 128435824 missense probably benign 0.31
Z1177:Fkbp4 UTSW 6 128433111 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAAGCTTCCTTCTGGTGGCC -3'
(R):5'- TCGGACCTGCTGAAAAGAAGC -3'

Sequencing Primer
(F):5'- AATCTCTGGTCGCTGGAAAC -3'
(R):5'- GCAGGGGGCAGTGGGTG -3'
Posted On2014-10-30