Incidental Mutation 'R2292:Letm1'
ID245026
Institutional Source Beutler Lab
Gene Symbol Letm1
Ensembl Gene ENSMUSG00000005299
Gene Nameleucine zipper-EF-hand containing transmembrane protein 1
Synonyms
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R2292 (G1)
Quality Score217
Status Validated
Chromosome5
Chromosomal Location33739673-33782817 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) A to AG at 33769515 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000005431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005431]
Predicted Effect probably null
Transcript: ENSMUST00000005431
SMART Domains Protein: ENSMUSP00000005431
Gene: ENSMUSG00000005299

DomainStartEndE-ValueType
low complexity region 10 30 N/A INTRINSIC
low complexity region 120 135 N/A INTRINSIC
Pfam:LETM1 152 417 1.2e-111 PFAM
coiled coil region 445 493 N/A INTRINSIC
low complexity region 503 513 N/A INTRINSIC
coiled coil region 537 598 N/A INTRINSIC
SCOP:d1c7va_ 647 691 4e-3 SMART
coiled coil region 708 738 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144071
Predicted Effect probably benign
Transcript: ENSMUST00000200827
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201981
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is localized to the inner mitochondrial membrane. The protein functions to maintain the mitochondrial tubular shapes and is required for normal mitochondrial morphology and cellular viability. Mutations in this gene cause Wolf-Hirschhorn syndrome, a complex malformation syndrome caused by the deletion of parts of the distal short arm of chromosome 4. Related pseudogenes have been identified on chromosomes 8, 15 and 19. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous deletion of this gene causes embryonic lethality prior to E6.5 while ~50% of heterozygotes die before E13.5. Surviving heterozygous mice show altered glucose metabolism, impaired control of brain ATP levels, and increased susceptibility to kainic acid-induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Map3k12 T C 15: 102,500,139 E870G probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Letm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Letm1 APN 5 33762590 missense possibly damaging 0.82
IGL01073:Letm1 APN 5 33748800 missense possibly damaging 0.89
IGL01882:Letm1 APN 5 33769665 missense probably benign 0.00
IGL02186:Letm1 APN 5 33745047 missense probably benign 0.00
IGL02699:Letm1 APN 5 33745148 missense possibly damaging 0.93
IGL03089:Letm1 APN 5 33760858 missense probably damaging 1.00
R0466:Letm1 UTSW 5 33761730 splice site probably benign
R0639:Letm1 UTSW 5 33769426 missense possibly damaging 0.88
R1370:Letm1 UTSW 5 33778682 splice site probably null
R1415:Letm1 UTSW 5 33769562 missense probably benign 0.06
R1511:Letm1 UTSW 5 33752555 missense probably damaging 1.00
R1714:Letm1 UTSW 5 33760884 missense possibly damaging 0.51
R1771:Letm1 UTSW 5 33769467 missense probably damaging 1.00
R1990:Letm1 UTSW 5 33769515 frame shift probably null
R1991:Letm1 UTSW 5 33769515 frame shift probably null
R2143:Letm1 UTSW 5 33769515 frame shift probably null
R2145:Letm1 UTSW 5 33769515 frame shift probably null
R2202:Letm1 UTSW 5 33769486 missense possibly damaging 0.64
R2290:Letm1 UTSW 5 33769515 frame shift probably null
R5574:Letm1 UTSW 5 33769386 missense possibly damaging 0.46
R6954:Letm1 UTSW 5 33782507 missense probably benign 0.35
R7265:Letm1 UTSW 5 33778648 missense possibly damaging 0.62
S24628:Letm1 UTSW 5 33747444 missense probably benign 0.00
S24628:Letm1 UTSW 5 33747446 missense probably benign
X0066:Letm1 UTSW 5 33762571 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTTTATCCAGAGGAGTAGAGC -3'
(R):5'- AACATGGACACCTGCCTCTG -3'

Sequencing Primer
(F):5'- TTTATCCAGAGGAGTAGAGCATAACC -3'
(R):5'- CTCTGCAAGGCTGGTGGTTAC -3'
Posted On2014-10-30