Incidental Mutation 'R2292:Map3k12'
ID245056
Institutional Source Beutler Lab
Gene Symbol Map3k12
Ensembl Gene ENSMUSG00000023050
Gene Namemitogen-activated protein kinase kinase kinase 12
SynonymsMUK, DLK, Zpk
MMRRC Submission 040291-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2292 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location102497646-102517064 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102500139 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 870 (E870G)
Ref Sequence ENSEMBL: ENSMUSP00000127629 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023812] [ENSMUST00000077037] [ENSMUST00000078404] [ENSMUST00000096145] [ENSMUST00000108838] [ENSMUST00000169377] [ENSMUST00000171565] [ENSMUST00000229061] [ENSMUST00000229184] [ENSMUST00000229618] [ENSMUST00000229802] [ENSMUST00000231085] [ENSMUST00000230114] [ENSMUST00000229854] [ENSMUST00000229918]
Predicted Effect probably damaging
Transcript: ENSMUST00000023812
AA Change: E870G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000023812
Gene: ENSMUSG00000023050
AA Change: E870G

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077037
SMART Domains Protein: ENSMUSP00000076294
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 283 353 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000078404
SMART Domains Protein: ENSMUSP00000077509
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 270 340 5.19e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000096145
SMART Domains Protein: ENSMUSP00000093859
Gene: ENSMUSG00000071586

DomainStartEndE-ValueType
low complexity region 29 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108838
SMART Domains Protein: ENSMUSP00000104466
Gene: ENSMUSG00000056851

DomainStartEndE-ValueType
KH 12 80 5.96e-15 SMART
KH 96 167 2.48e-12 SMART
KH 252 322 5.19e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000169377
AA Change: E870G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000133209
Gene: ENSMUSG00000023050
AA Change: E870G

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 159 397 1.2e-58 PFAM
Pfam:Pkinase_Tyr 160 397 3.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171565
AA Change: E870G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127629
Gene: ENSMUSG00000023050
AA Change: E870G

DomainStartEndE-ValueType
low complexity region 54 75 N/A INTRINSIC
Pfam:Pkinase 158 397 3.3e-59 PFAM
Pfam:Pkinase_Tyr 159 397 2.7e-62 PFAM
coiled coil region 447 501 N/A INTRINSIC
low complexity region 559 577 N/A INTRINSIC
low complexity region 599 617 N/A INTRINSIC
low complexity region 640 663 N/A INTRINSIC
low complexity region 664 678 N/A INTRINSIC
low complexity region 691 727 N/A INTRINSIC
low complexity region 751 764 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000229061
Predicted Effect probably benign
Transcript: ENSMUST00000229184
Predicted Effect probably benign
Transcript: ENSMUST00000229432
Predicted Effect probably benign
Transcript: ENSMUST00000229618
Predicted Effect probably benign
Transcript: ENSMUST00000229802
Predicted Effect probably benign
Transcript: ENSMUST00000231085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230631
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229822
Predicted Effect probably benign
Transcript: ENSMUST00000230114
Predicted Effect probably benign
Transcript: ENSMUST00000229854
Predicted Effect probably benign
Transcript: ENSMUST00000229918
Meta Mutation Damage Score 0.0989 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 94.8%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. This kinase contains a leucine-zipper domain and is predominately expressed in neuronal cells. The phosphorylation state of this kinase in synaptic terminals was shown to be regulated by membrane depolarization via calcineurin. This kinase forms heterodimers with leucine zipper containing transcription factors, such as cAMP responsive element binding protein (CREB) and MYC, and thus may play a regulatory role in PKA or retinoic acid induced neuronal differentiation. Alternatively spliced transcript variants encoding different proteins have been described.[provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for a gene-trapped allele lack the brain anterior commissure. Mice homozygous for a knock-out allele exhibit postnatal lethality and abnormal axon growth and radial migration of neocortical pyramidal neurons. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932414N04Rik T C 2: 68,732,139 I370T probably benign Het
A2m A G 6: 121,673,559 T1209A possibly damaging Het
Als2 T C 1: 59,187,385 Q920R probably damaging Het
Arhgap20 T A 9: 51,849,443 Y829N possibly damaging Het
Arhgap35 A T 7: 16,563,551 F530I probably damaging Het
Arid4a G T 12: 71,061,541 G40V probably damaging Het
Ascc2 T C 11: 4,679,352 probably benign Het
Cacna1b C T 2: 24,606,620 V2312I probably benign Het
Dctn6 T C 8: 34,092,525 T159A probably benign Het
Ddx55 G T 5: 124,568,077 A522S probably benign Het
Dnah6 G A 6: 73,021,109 T4110I probably damaging Het
Dvl1 G A 4: 155,847,816 V28I possibly damaging Het
Dym A G 18: 75,199,212 T504A possibly damaging Het
E130308A19Rik T C 4: 59,690,579 Y138H probably damaging Het
Fgd4 A T 16: 16,436,000 C568S possibly damaging Het
Fkbp4 A C 6: 128,436,662 V6G probably damaging Het
Flg2 A T 3: 93,220,677 S2299C unknown Het
Gdf2 A T 14: 33,945,188 N289I possibly damaging Het
Gm13023 T C 4: 143,793,876 I66T probably benign Het
Gpr182 A G 10: 127,750,182 I300T possibly damaging Het
Iqcg A G 16: 33,049,883 V80A probably benign Het
Letm1 A AG 5: 33,769,515 probably null Het
Lyst T G 13: 13,740,495 F3258C probably damaging Het
Mphosph10 G A 7: 64,385,771 P384L probably damaging Het
Ncoa4 T G 14: 32,173,456 L179R probably damaging Het
Nlrp1c-ps A G 11: 71,246,362 noncoding transcript Het
Nwd2 A T 5: 63,805,574 M834L probably benign Het
Olfr1361 A G 13: 21,658,831 M164T probably damaging Het
Olfr517 A T 7: 108,869,016 M46K probably benign Het
Pccb T C 9: 100,994,632 E266G probably benign Het
Pcdhb2 T A 18: 37,297,244 probably null Het
Prdm13 A C 4: 21,683,914 I119S unknown Het
Tchh A G 3: 93,442,382 Y18C probably damaging Het
Tmem192 T C 8: 64,959,346 V59A probably damaging Het
Trak2 A T 1: 58,935,757 F92Y probably damaging Het
Trappc11 C T 8: 47,505,736 G40D probably damaging Het
Ttc23 A T 7: 67,669,787 I132F probably benign Het
Ttc9b A G 7: 27,655,980 D225G probably benign Het
Ubr3 G T 2: 69,897,260 probably benign Het
Vmn2r75 A C 7: 86,148,936 C556W probably damaging Het
Zbtb41 T C 1: 139,440,359 V595A probably damaging Het
Other mutations in Map3k12
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01615:Map3k12 APN 15 102503751 missense probably damaging 1.00
IGL01713:Map3k12 APN 15 102502321 missense probably damaging 1.00
IGL01720:Map3k12 APN 15 102502186 unclassified probably benign
IGL02262:Map3k12 APN 15 102502075 missense probably damaging 1.00
IGL02670:Map3k12 APN 15 102503546 missense probably benign 0.09
IGL03004:Map3k12 APN 15 102504196 missense possibly damaging 0.96
IGL03369:Map3k12 APN 15 102502079 missense possibly damaging 0.47
react UTSW 15 102505402 missense probably damaging 1.00
R0894:Map3k12 UTSW 15 102502178 missense probably damaging 1.00
R0918:Map3k12 UTSW 15 102503852 missense probably damaging 0.99
R1547:Map3k12 UTSW 15 102503852 missense probably damaging 1.00
R1844:Map3k12 UTSW 15 102503535 missense probably damaging 1.00
R1880:Map3k12 UTSW 15 102502064 critical splice donor site probably null
R4397:Map3k12 UTSW 15 102501259 missense probably benign 0.44
R4406:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4407:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4408:Map3k12 UTSW 15 102505402 missense probably damaging 1.00
R4731:Map3k12 UTSW 15 102501282 missense probably benign 0.28
R5074:Map3k12 UTSW 15 102501832 critical splice donor site probably null
R5605:Map3k12 UTSW 15 102503865 missense probably benign 0.17
R5848:Map3k12 UTSW 15 102504235 missense possibly damaging 0.66
R6232:Map3k12 UTSW 15 102503646 missense probably damaging 0.99
R6901:Map3k12 UTSW 15 102500629 missense possibly damaging 0.95
R6901:Map3k12 UTSW 15 102500630 missense possibly damaging 0.65
R6946:Map3k12 UTSW 15 102505134 missense possibly damaging 0.89
R7291:Map3k12 UTSW 15 102502166 missense probably damaging 1.00
R7874:Map3k12 UTSW 15 102500642 missense possibly damaging 0.91
R8331:Map3k12 UTSW 15 102502331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GAACTTATTCGGTAATTGGTCAGGG -3'
(R):5'- TGTGGCAGCTTTGATGACAG -3'

Sequencing Primer
(F):5'- GGCGTCGTTCACTCTCAAG -3'
(R):5'- AATGTAAAAGAAGGGTCCC -3'
Posted On2014-10-30