Incidental Mutation 'R2846:Ppfia3'
ID251595
Institutional Source Beutler Lab
Gene Symbol Ppfia3
Ensembl Gene ENSMUSG00000003863
Gene Nameprotein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 3
Synonyms
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.632) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location45339122-45367019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 45356428 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 348 (R348L)
Ref Sequence ENSEMBL: ENSMUSP00000148200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003961] [ENSMUST00000210248] [ENSMUST00000211067]
Predicted Effect probably damaging
Transcript: ENSMUST00000003961
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000003961
Gene: ENSMUSG00000003863
AA Change: R348L

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107779
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103408
Gene: ENSMUSG00000003863
AA Change: R348L

DomainStartEndE-ValueType
coiled coil region 27 129 N/A INTRINSIC
coiled coil region 167 426 N/A INTRINSIC
coiled coil region 448 500 N/A INTRINSIC
low complexity region 534 550 N/A INTRINSIC
coiled coil region 597 642 N/A INTRINSIC
low complexity region 651 672 N/A INTRINSIC
low complexity region 707 719 N/A INTRINSIC
SAM 835 904 1.46e-10 SMART
SAM 950 1017 8.22e-5 SMART
SAM 1038 1110 3.58e-5 SMART
low complexity region 1156 1169 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000137578
AA Change: R197L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118183
Gene: ENSMUSG00000003863
AA Change: R197L

DomainStartEndE-ValueType
coiled coil region 16 275 N/A INTRINSIC
coiled coil region 297 349 N/A INTRINSIC
low complexity region 383 399 N/A INTRINSIC
coiled coil region 446 491 N/A INTRINSIC
low complexity region 500 521 N/A INTRINSIC
low complexity region 556 568 N/A INTRINSIC
SAM 684 753 1.46e-10 SMART
SAM 790 857 8.22e-5 SMART
SAM 878 950 3.58e-5 SMART
low complexity region 996 1009 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000210248
AA Change: R197L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210479
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210586
Predicted Effect probably damaging
Transcript: ENSMUST00000211067
AA Change: R348L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.4975 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the LAR protein-tyrosine phosphatase-interacting protein (liprin) family. Liprins interact with members of LAR family of transmembrane protein tyrosine phosphatases, which are known to be important for axon guidance and mammary gland development. Liprin family protein has been shown to localize phosphatase LAR to cell focal adhesions and may be involved in the molecular organization of presynaptic active zones. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Plekha1 G T 7: 130,908,365 W280C probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Ppfia3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01783:Ppfia3 APN 7 45360057 splice site probably null
IGL02086:Ppfia3 APN 7 45340572 unclassified probably benign
IGL02160:Ppfia3 APN 7 45360051 splice site probably benign
IGL02373:Ppfia3 APN 7 45358849 missense probably damaging 0.98
IGL02417:Ppfia3 APN 7 45341717 missense probably damaging 0.98
IGL02501:Ppfia3 APN 7 45354938 splice site probably benign
IGL02638:Ppfia3 APN 7 45356668 missense probably damaging 1.00
IGL03084:Ppfia3 APN 7 45340227 missense probably benign 0.00
R0207:Ppfia3 UTSW 7 45348534 missense probably damaging 1.00
R0962:Ppfia3 UTSW 7 45347722 splice site probably benign
R1086:Ppfia3 UTSW 7 45361758 missense probably damaging 1.00
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1146:Ppfia3 UTSW 7 45352215 missense probably benign 0.19
R1566:Ppfia3 UTSW 7 45340688 missense probably damaging 1.00
R1677:Ppfia3 UTSW 7 45356666 missense probably benign 0.03
R1876:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.75
R2219:Ppfia3 UTSW 7 45354890 nonsense probably null
R2336:Ppfia3 UTSW 7 45356697 splice site probably null
R2843:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R2844:Ppfia3 UTSW 7 45356428 missense probably damaging 1.00
R4669:Ppfia3 UTSW 7 45352093 missense probably damaging 1.00
R4777:Ppfia3 UTSW 7 45341157 missense probably damaging 1.00
R4787:Ppfia3 UTSW 7 45340626 missense possibly damaging 0.89
R4994:Ppfia3 UTSW 7 45341118 missense probably damaging 1.00
R5042:Ppfia3 UTSW 7 45342341 missense probably damaging 1.00
R5821:Ppfia3 UTSW 7 45353616 missense probably damaging 0.96
R6116:Ppfia3 UTSW 7 45354703 missense probably damaging 1.00
R6515:Ppfia3 UTSW 7 45340233 missense possibly damaging 0.94
R6868:Ppfia3 UTSW 7 45353612 missense probably damaging 1.00
R6920:Ppfia3 UTSW 7 45358807 missense possibly damaging 0.46
R6935:Ppfia3 UTSW 7 45352207 missense possibly damaging 0.47
R6978:Ppfia3 UTSW 7 45346848 missense probably benign 0.02
R7017:Ppfia3 UTSW 7 45358800 missense probably benign
R7027:Ppfia3 UTSW 7 45354736 missense possibly damaging 0.80
R7078:Ppfia3 UTSW 7 45360595 missense probably damaging 1.00
R7256:Ppfia3 UTSW 7 45341743 missense probably benign 0.43
R7378:Ppfia3 UTSW 7 45361446 intron probably null
R7570:Ppfia3 UTSW 7 45340748 critical splice acceptor site probably null
R7814:Ppfia3 UTSW 7 45352262 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCAAAGTTCCCATGGCGTTCC -3'
(R):5'- ATGCCAACGACAAGCTGGAG -3'

Sequencing Primer
(F):5'- TTCCTCAGCCTAGTGGACAG -3'
(R):5'- CTGGAGAATGAGTTGGCCAGC -3'
Posted On2014-12-04