Incidental Mutation 'R2846:Plekha1'
ID251597
Institutional Source Beutler Lab
Gene Symbol Plekha1
Ensembl Gene ENSMUSG00000040268
Gene Namepleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1
SynonymsTAPP1, C920009D07Rik
MMRRC Submission 040439-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.212) question?
Stock #R2846 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location130865756-130913312 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 130908365 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Cysteine at position 280 (W280C)
Ref Sequence ENSEMBL: ENSMUSP00000112777 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048180] [ENSMUST00000075181] [ENSMUST00000120441] [ENSMUST00000124096] [ENSMUST00000151119]
Predicted Effect probably damaging
Transcript: ENSMUST00000048180
AA Change: W232C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035375
Gene: ENSMUSG00000040268
AA Change: W232C

DomainStartEndE-ValueType
PDB:1V5P|A 1 75 2e-33 PDB
Blast:PH 8 78 1e-36 BLAST
PH 144 243 1.71e-21 SMART
low complexity region 244 261 N/A INTRINSIC
low complexity region 268 287 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000075181
AA Change: W280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074675
Gene: ENSMUSG00000040268
AA Change: W280C

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
low complexity region 330 341 N/A INTRINSIC
low complexity region 370 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120441
AA Change: W280C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112777
Gene: ENSMUSG00000040268
AA Change: W280C

DomainStartEndE-ValueType
PH 8 114 2.16e-9 SMART
PH 192 291 1.71e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000126355
AA Change: W41C
SMART Domains Protein: ENSMUSP00000114411
Gene: ENSMUSG00000040268
AA Change: W41C

DomainStartEndE-ValueType
Pfam:PH 2 51 6e-8 PFAM
low complexity region 102 113 N/A INTRINSIC
low complexity region 142 153 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135359
Predicted Effect probably benign
Transcript: ENSMUST00000136963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146111
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149029
Predicted Effect unknown
Transcript: ENSMUST00000151119
AA Change: W280C
SMART Domains Protein: ENSMUSP00000123600
Gene: ENSMUSG00000040268
AA Change: W280C

DomainStartEndE-ValueType
PDB:1V5P|A 1 67 3e-35 PDB
Blast:PH 8 67 7e-38 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198082
Meta Mutation Damage Score 0.9372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pleckstrin homology domain-containing adapter protein. The encoded protein is localized to the plasma membrane where it specifically binds phosphatidylinositol 3,4-bisphosphate. This protein may be involved in the formation of signaling complexes in the plasma membrane. Polymorphisms in this gene are associated with age-related macular degeneration. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 5.[provided by RefSeq, Sep 2010]
PHENOTYPE: Mcie homozygous for a gene trapped allele exhibit postnatal lethality and increased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atg4a G A X: 140,992,840 E106K probably benign Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Cdnf T A 2: 3,513,128 M1K probably null Het
Ddx4 T A 13: 112,604,612 K496M probably damaging Het
Dlg1 T C 16: 31,863,197 S779P probably damaging Het
Dtna T A 18: 23,651,503 probably null Het
Fhad1 G T 4: 141,904,968 Q1287K probably benign Het
Gal3st2c A T 1: 93,996,400 Q8L possibly damaging Het
Hsd3b1 T C 3: 98,852,778 E299G probably damaging Het
Hydin T C 8: 110,519,114 V2153A probably benign Het
Irs4 C A X: 141,724,340 G287W probably damaging Het
Kif21a T C 15: 90,934,464 I1570V probably benign Het
Kremen1 GG GGGCG 11: 5,201,793 probably benign Het
Mark2 T C 19: 7,286,862 E116G probably damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mindy4 T C 6: 55,278,100 V521A probably damaging Het
Olfr119 T C 17: 37,700,823 I51T probably damaging Het
Olfr384 A T 11: 73,603,383 T268S probably benign Het
Pdgfrb C T 18: 61,064,016 P175S probably benign Het
Pign C A 1: 105,657,796 L9F possibly damaging Het
Ppfia3 C A 7: 45,356,428 R348L probably damaging Het
Prr12 G C 7: 45,046,012 S1343R unknown Het
Psmd13 C A 7: 140,897,740 probably benign Het
Qpct A G 17: 79,070,742 T114A probably damaging Het
Sec24d A G 3: 123,350,746 D624G probably damaging Het
Shank2 A G 7: 144,070,055 Y259C probably damaging Het
Slc15a4 A G 5: 127,604,536 probably null Het
Smarcb1 C A 10: 75,897,541 R332L probably damaging Het
Ssh3 T C 19: 4,265,296 Y338C probably damaging Het
St18 T A 1: 6,845,587 C819S probably damaging Het
Tas2r124 A G 6: 132,755,267 N180D possibly damaging Het
Tgfbr3l A G 8: 4,249,280 D49G probably damaging Het
Tmem204 G A 17: 25,080,333 H71Y probably benign Het
Vmn1r212 A G 13: 22,884,092 S24P probably damaging Het
Vmn2r6 A G 3: 64,556,790 S208P possibly damaging Het
Zbtb8os A T 4: 129,341,516 E54D probably damaging Het
Zmiz1 A G 14: 25,645,675 S259G probably benign Het
Other mutations in Plekha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00495:Plekha1 APN 7 130877839 missense probably damaging 1.00
IGL00973:Plekha1 APN 7 130911013 missense probably damaging 0.96
IGL01010:Plekha1 APN 7 130902254 splice site probably benign
IGL01726:Plekha1 APN 7 130897329 missense probably damaging 1.00
R0137:Plekha1 UTSW 7 130897446 missense probably damaging 0.98
R0681:Plekha1 UTSW 7 130900623 missense possibly damaging 0.50
R1304:Plekha1 UTSW 7 130902219 missense probably benign
R1786:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R2036:Plekha1 UTSW 7 130902192 missense probably damaging 1.00
R2844:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R2845:Plekha1 UTSW 7 130908365 missense probably damaging 1.00
R5119:Plekha1 UTSW 7 130905364 intron probably benign
R5167:Plekha1 UTSW 7 130885449 critical splice donor site probably null
R5470:Plekha1 UTSW 7 130908376 missense probably damaging 1.00
R5536:Plekha1 UTSW 7 130909601 missense probably damaging 0.96
R5975:Plekha1 UTSW 7 130892253 missense probably benign 0.02
R6087:Plekha1 UTSW 7 130900571 missense probably benign 0.06
R6346:Plekha1 UTSW 7 130877782 missense probably benign 0.17
R7581:Plekha1 UTSW 7 130910865 missense probably benign
R8152:Plekha1 UTSW 7 130908372 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGACAGCTGGACCAATGAC -3'
(R):5'- GAAGCTCTCAGTTAGGGTGC -3'

Sequencing Primer
(F):5'- TTTAATCTCAGCACTCAGGAGGCAG -3'
(R):5'- GCAAGTCCAATTGGTATGAAAGTC -3'
Posted On2014-12-04