Incidental Mutation 'R3702:Pip4k2b'
ID258577
Institutional Source Beutler Lab
Gene Symbol Pip4k2b
Ensembl Gene ENSMUSG00000018547
Gene Namephosphatidylinositol-5-phosphate 4-kinase, type II, beta
SynonymsPip5k2b, PI5P4Kbeta, c11
MMRRC Submission 040695-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.250) question?
Stock #R3702 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location97715157-97744704 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 97729548 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000018691 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018691]
Predicted Effect probably benign
Transcript: ENSMUST00000018691
SMART Domains Protein: ENSMUSP00000018691
Gene: ENSMUSG00000018547

DomainStartEndE-ValueType
PIPKc 67 416 4.49e-156 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144012
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene catalyzes the phosphorylation of phosphatidylinositol-5-phosphate on the fourth hydroxyl of the myo-inositol ring to form phosphatidylinositol-5,4-bisphosphate. This gene is a member of the phosphatidylinositol-5-phosphate 4-kinase family. The encoded protein sequence does not show similarity to other kinases, but the protein does exhibit kinase activity. Additionally, the encoded protein interacts with p55 TNF receptor. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene are smaller than normal with less body fat and an increased sensitivity to insulin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010111I01Rik A T 13: 63,015,330 N55I probably benign Het
9530053A07Rik G A 7: 28,157,778 V2184M probably damaging Het
Abca5 C T 11: 110,288,058 probably null Het
Cacna1a T G 8: 84,617,846 S1846A probably damaging Het
Cacna1i A T 15: 80,381,071 probably benign Het
Calhm3 T A 19: 47,151,748 D302V possibly damaging Het
Cluh A G 11: 74,665,356 M878V probably benign Het
Col24a1 C T 3: 145,337,860 H603Y probably benign Het
Commd1 T A 11: 22,974,057 L277H probably damaging Het
Cpped1 G T 16: 11,828,440 D135E probably damaging Het
Cul5 T C 9: 53,629,216 K499E probably damaging Het
Elfn1 A G 5: 139,972,359 T373A probably benign Het
Fam83h C T 15: 76,002,650 R946K probably benign Het
Gm10608 CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA CAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA 9: 119,160,716 probably null Het
Grik4 T C 9: 42,675,218 K114E probably damaging Het
Hivep1 T C 13: 42,157,727 S1148P probably benign Het
Itgb1bp2 T C X: 101,451,687 probably benign Het
Lrp1 C A 10: 127,595,103 R359L probably damaging Het
Lyn A G 4: 3,742,455 H28R probably benign Het
Mtmr10 T C 7: 64,337,899 L729P probably damaging Het
Myot T A 18: 44,354,095 probably null Het
Obox2 G T 7: 15,396,957 R38L probably benign Het
Olfr787 A T 10: 129,462,952 Y92F probably damaging Het
Pcdha3 A G 18: 36,947,348 Q381R probably benign Het
Ppig T A 2: 69,733,209 S89T probably damaging Het
Prune2 A G 19: 17,178,871 D47G probably damaging Het
Sh2b2 A G 5: 136,224,233 S362P probably damaging Het
Snap91 G A 9: 86,806,520 T322I probably damaging Het
Taf3 G A 2: 9,952,561 T112I possibly damaging Het
Tcea1 T C 1: 4,894,935 V276A probably benign Het
Tex15 T C 8: 33,574,166 V1208A probably benign Het
Tomm40 G T 7: 19,713,673 T144K possibly damaging Het
Zbed5 G A 5: 129,903,159 D650N possibly damaging Het
Zfp326 A G 5: 105,888,843 probably null Het
Zfp647 G A 15: 76,910,910 R517W probably damaging Het
Other mutations in Pip4k2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Pip4k2b APN 11 97744505 missense probably damaging 1.00
IGL01567:Pip4k2b APN 11 97729561 missense probably damaging 0.99
IGL01568:Pip4k2b APN 11 97729552 critical splice donor site probably null
IGL03004:Pip4k2b APN 11 97724474 missense probably damaging 1.00
bigun UTSW 11 97722936 splice site probably benign
yuge UTSW 11 97722434 missense probably benign 0.04
R0119:Pip4k2b UTSW 11 97722936 splice site probably benign
R0657:Pip4k2b UTSW 11 97722936 splice site probably benign
R1223:Pip4k2b UTSW 11 97718894 missense probably damaging 1.00
R1252:Pip4k2b UTSW 11 97744594 missense probably benign 0.45
R2914:Pip4k2b UTSW 11 97722434 missense probably benign 0.04
R4173:Pip4k2b UTSW 11 97722375 missense probably benign 0.06
R4998:Pip4k2b UTSW 11 97722435 missense possibly damaging 0.49
R5084:Pip4k2b UTSW 11 97719743 missense probably damaging 1.00
R5128:Pip4k2b UTSW 11 97718876 missense probably benign 0.01
R6590:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R6690:Pip4k2b UTSW 11 97729567 missense probably damaging 1.00
R7104:Pip4k2b UTSW 11 97732716 missense possibly damaging 0.83
R7676:Pip4k2b UTSW 11 97720362 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GGGTTCTTCAGCCTAGACTG -3'
(R):5'- AAGGCTCTGGTGTTGCTCAG -3'

Sequencing Primer
(F):5'- TAGACTGGGCGTGTCAGAC -3'
(R):5'- CAGGCTGAGTTAGGGTGGTTCAC -3'
Posted On2015-01-23