Incidental Mutation 'R3024:Vmn1r238'
List |< first << previous [record 21 of 23] next >> last >|
ID265785
Institutional Source Beutler Lab
Gene Symbol Vmn1r238
Ensembl Gene ENSMUSG00000091539
Gene Namevomeronasal 1 receptor, 238
Synonyms
MMRRC Submission 040540-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R3024 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location3122492-3123412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3123305 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 36 (I36M)
Ref Sequence ENSEMBL: ENSMUSP00000129804 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165255]
Predicted Effect probably benign
Transcript: ENSMUST00000165255
AA Change: I36M

PolyPhen 2 Score 0.126 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000129804
Gene: ENSMUSG00000091539
AA Change: I36M

DomainStartEndE-ValueType
Pfam:TAS2R 7 302 5.3e-8 PFAM
Pfam:7tm_1 27 292 8.8e-7 PFAM
Pfam:V1R 34 298 1.9e-33 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arhgef37 T C 18: 61,501,888 E461G probably damaging Het
Bfsp1 A T 2: 143,845,959 V182D probably benign Het
Birc6 T C 17: 74,608,219 S1635P possibly damaging Het
Chil6 T C 3: 106,388,770 D383G probably damaging Het
Itpr2 G A 6: 146,180,310 A175V probably benign Het
Kcnh7 G T 2: 62,764,663 R688S probably damaging Het
Krt6a A T 15: 101,691,289 C463S probably benign Het
Ksr2 T A 5: 117,555,060 I191N possibly damaging Het
Lyst T C 13: 13,658,687 V1698A probably benign Het
Olfr103 A T 17: 37,337,027 D68E probably damaging Het
Olfr1262 A T 2: 90,003,240 N278I probably damaging Het
Pappa2 C T 1: 158,936,225 R572Q probably benign Het
Pes1 CGGAGGAGGAGGAGGAGGAGGAGG CGGAGGAGGAGGAGGAGGAGG 11: 3,977,719 probably benign Het
Phf20 A G 2: 156,287,867 H453R probably damaging Het
Prex1 G T 2: 166,589,036 H615Q probably benign Het
Slc25a54 T A 3: 109,080,666 I41N probably damaging Het
Slc35f5 A G 1: 125,568,598 S157G probably benign Het
Sstr3 G A 15: 78,539,987 R187W probably damaging Het
Trim41 T C 11: 48,808,158 K420E possibly damaging Het
Tsnaxip1 A G 8: 105,841,743 Y353C probably damaging Het
Xylt1 T A 7: 117,548,648 V149D probably damaging Het
Zfpm2 G A 15: 41,102,959 E815K probably benign Het
Other mutations in Vmn1r238
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Vmn1r238 APN 18 3123243 missense probably benign 0.01
IGL01385:Vmn1r238 APN 18 3122770 missense possibly damaging 0.83
IGL02716:Vmn1r238 APN 18 3123124 missense probably damaging 1.00
R1219:Vmn1r238 UTSW 18 3123135 missense possibly damaging 0.81
R1568:Vmn1r238 UTSW 18 3123358 missense probably benign 0.00
R1864:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4291:Vmn1r238 UTSW 18 3123214 nonsense probably null
R4304:Vmn1r238 UTSW 18 3123040 nonsense probably null
R4586:Vmn1r238 UTSW 18 3123294 missense probably damaging 1.00
R4664:Vmn1r238 UTSW 18 3123300 missense probably damaging 0.99
R5123:Vmn1r238 UTSW 18 3123243 missense probably benign
R5430:Vmn1r238 UTSW 18 3122521 missense possibly damaging 0.63
R5834:Vmn1r238 UTSW 18 3123168 missense probably benign
R7186:Vmn1r238 UTSW 18 3122661 missense probably damaging 0.99
R7206:Vmn1r238 UTSW 18 3122623 missense possibly damaging 0.94
R7308:Vmn1r238 UTSW 18 3122875 missense probably benign 0.09
R7346:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R7467:Vmn1r238 UTSW 18 3123393 missense probably benign 0.10
R7571:Vmn1r238 UTSW 18 3122721 missense probably damaging 1.00
R7808:Vmn1r238 UTSW 18 3123033 missense probably benign 0.03
R8085:Vmn1r238 UTSW 18 3123151 missense probably damaging 1.00
R8086:Vmn1r238 UTSW 18 3123250 missense probably damaging 1.00
Z1177:Vmn1r238 UTSW 18 3122505 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAAACAACTCACTAGGCACA -3'
(R):5'- ATGCTTTATTTATGCTTACTTCACCA -3'

Sequencing Primer
(F):5'- GCACATAGCATAAAGAGACACC -3'
(R):5'- CAAGTTCAGGGATTTTGGAC -3'
Posted On2015-02-05