Incidental Mutation 'R3788:Olfr873'
ID272385
Institutional Source Beutler Lab
Gene Symbol Olfr873
Ensembl Gene ENSMUSG00000049028
Gene Nameolfactory receptor 873
SynonymsGA_x6K02T2PVTD-14040245-14041204, MOR145-2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R3788 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20298532-20303599 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 20300370 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 58 (I58V)
Ref Sequence ENSEMBL: ENSMUSP00000075135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053919] [ENSMUST00000075717] [ENSMUST00000215540]
Predicted Effect probably benign
Transcript: ENSMUST00000053919
AA Change: I54V

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000054778
Gene: ENSMUSG00000049028
AA Change: I54V

DomainStartEndE-ValueType
Pfam:7tm_4 41 317 1.7e-52 PFAM
Pfam:7TM_GPCR_Srsx 45 315 1.6e-8 PFAM
Pfam:7tm_1 51 300 3e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000075717
AA Change: I58V

PolyPhen 2 Score 0.129 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: I58V

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212393
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212793
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213057
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213445
Predicted Effect probably benign
Transcript: ENSMUST00000215540
AA Change: I57V

PolyPhen 2 Score 0.035 (Sensitivity: 0.94; Specificity: 0.82)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216567
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217193
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik T A 11: 78,288,297 probably null Het
Abca4 T A 3: 122,052,912 V26E possibly damaging Het
Abhd16a A G 17: 35,101,587 N411S probably damaging Het
Akap13 G A 7: 75,702,153 probably null Het
Aph1b T C 9: 66,794,066 probably benign Het
Aspm C T 1: 139,463,203 T742I probably damaging Het
Bclaf3 A G X: 159,566,496 H619R probably benign Het
Cemip A T 7: 83,943,898 L1199H probably damaging Het
Chd2 G A 7: 73,447,130 probably benign Het
Clnk A G 5: 38,714,998 Y310H probably damaging Het
Crmp1 A G 5: 37,284,140 D522G probably damaging Het
Cyth3 A G 5: 143,636,543 probably benign Het
Dcbld1 T A 10: 52,319,658 Y392N probably damaging Het
Fam60a A G 6: 148,926,119 S134P possibly damaging Het
Flnc T C 6: 29,454,057 F1820L probably damaging Het
Galnt18 G A 7: 111,520,115 R385* probably null Het
Gpatch3 C A 4: 133,575,168 R137S possibly damaging Het
Gpc6 C T 14: 117,624,466 P265S probably damaging Het
Harbi1 T A 2: 91,720,607 D308E probably benign Het
Hdhd2 G A 18: 76,955,187 probably null Het
Hk1 T C 10: 62,275,688 K737E possibly damaging Het
Hnrnpr G A 4: 136,336,313 V345M probably damaging Het
Kalrn T C 16: 34,220,240 H944R probably damaging Het
Kdm2a A T 19: 4,351,805 C207S probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Krt75 C T 15: 101,573,521 G104D possibly damaging Het
Lnpk A T 2: 74,522,263 S358R probably benign Het
Map2 A G 1: 66,416,863 T1512A probably damaging Het
March10 T A 11: 105,397,079 L132F probably damaging Het
Mfrp G A 9: 44,105,457 W65* probably null Het
Mgat5 A G 1: 127,366,443 D174G probably benign Het
Miga2 T A 2: 30,371,225 Y177* probably null Het
Mroh3 T C 1: 136,185,475 D747G probably damaging Het
Muc5b A G 7: 141,863,834 T3506A possibly damaging Het
Myo7b G T 18: 31,974,112 P1277T possibly damaging Het
Naaa C T 5: 92,272,554 probably null Het
Ndufs2 T C 1: 171,235,320 D410G possibly damaging Het
Olfr506 T A 7: 108,613,073 Y255* probably null Het
Olfr559 A G 7: 102,723,487 probably null Het
Olfr955 A G 9: 39,470,069 I219T probably benign Het
Osbp A T 19: 11,978,921 Y409F probably benign Het
Plxnb1 T A 9: 109,109,287 V1303D possibly damaging Het
Prkcg G A 7: 3,313,747 D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,219,203 probably benign Het
Sbf1 G A 15: 89,299,528 R1261* probably null Het
Scn4a T C 11: 106,344,274 N341S probably damaging Het
Sec61a2 C A 2: 5,879,625 probably null Het
Sgcd T A 11: 47,355,205 K57* probably null Het
Slc12a5 T C 2: 164,993,775 L861P probably damaging Het
Slc6a16 A G 7: 45,259,962 D184G probably benign Het
Snx7 A G 3: 117,838,990 probably benign Het
Sptbn2 A G 19: 4,745,922 I1710V probably damaging Het
Sytl2 A T 7: 90,376,081 I426F probably benign Het
Tdp1 A G 12: 99,891,752 probably benign Het
Tmem232 C A 17: 65,382,633 D496Y possibly damaging Het
Tomm20l C T 12: 71,111,742 A58V possibly damaging Het
Ttc26 T A 6: 38,403,524 probably null Het
Ttn T C 2: 76,945,274 E1854G unknown Het
Ttn A G 2: 76,974,208 V240A probably benign Het
Vmn2r98 A T 17: 19,080,625 T630S probably benign Het
Xrcc1 G C 7: 24,566,908 A220P probably benign Het
Other mutations in Olfr873
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02122:Olfr873 APN 9 20300584 missense probably damaging 1.00
IGL02268:Olfr873 APN 9 20300292 missense probably damaging 1.00
IGL02416:Olfr873 APN 9 20300245 missense probably benign 0.01
IGL03124:Olfr873 APN 9 20301163 missense probably benign 0.00
R0147:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0148:Olfr873 UTSW 9 20301091 missense probably damaging 1.00
R0266:Olfr873 UTSW 9 20301158 missense probably benign 0.01
R0831:Olfr873 UTSW 9 20300565 missense probably benign 0.20
R1456:Olfr873 UTSW 9 20300838 missense probably benign 0.35
R1894:Olfr873 UTSW 9 20300337 missense probably benign 0.23
R1928:Olfr873 UTSW 9 20301058 missense probably benign 0.12
R2135:Olfr873 UTSW 9 20300297 missense probably benign 0.00
R2379:Olfr873 UTSW 9 20300667 missense possibly damaging 0.87
R2911:Olfr873 UTSW 9 20300479 missense possibly damaging 0.60
R4657:Olfr873 UTSW 9 20300623 missense probably damaging 1.00
R5754:Olfr873 UTSW 9 20301094 missense probably damaging 1.00
R6291:Olfr873 UTSW 9 20300603 missense probably damaging 1.00
R6410:Olfr873 UTSW 9 20300452 missense probably damaging 1.00
R7014:Olfr873 UTSW 9 20300663 nonsense probably null
R7521:Olfr873 UTSW 9 20300740 missense probably benign 0.00
R8201:Olfr873 UTSW 9 20301021 missense probably damaging 1.00
R8355:Olfr873 UTSW 9 20300419 missense probably damaging 1.00
R8455:Olfr873 UTSW 9 20300419 missense probably damaging 1.00
R8523:Olfr873 UTSW 9 20300797 missense probably benign 0.10
R8874:Olfr873 UTSW 9 20300773 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- CAGTGTCGAGTGATAGTAAACTTC -3'
(R):5'- GGCCATCACAGTCAGAAGCAAG -3'

Sequencing Primer
(F):5'- GTCTCAGAATTCCATCTCATG -3'
(R):5'- AAAAATGACATCTGTGTAAGGCATCC -3'
Posted On2015-03-25