Incidental Mutation 'R3788:Vmn2r98'
ID 272405
Institutional Source Beutler Lab
Gene Symbol Vmn2r98
Ensembl Gene ENSMUSG00000096717
Gene Name vomeronasal 2, receptor 98
Synonyms EG224552
Accession Numbers
Essential gene? Probably non essential (E-score: 0.142) question?
Stock # R3788 (G1)
Quality Score 225
Status Validated
Chromosome 17
Chromosomal Location 19273755-19301573 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 19300887 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 630 (T630S)
Ref Sequence ENSEMBL: ENSMUSP00000131261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000170424]
AlphaFold E9PZ56
Predicted Effect probably benign
Transcript: ENSMUST00000170424
AA Change: T630S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: T630S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 460 2.6e-35 PFAM
Pfam:NCD3G 509 562 7.4e-22 PFAM
Pfam:7tm_3 594 830 1.4e-52 PFAM
low complexity region 844 856 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 121,846,561 (GRCm39) V26E possibly damaging Het
Abhd16a A G 17: 35,320,563 (GRCm39) N411S probably damaging Het
Akap13 G A 7: 75,351,901 (GRCm39) probably null Het
Aph1b T C 9: 66,701,348 (GRCm39) probably benign Het
Aspm C T 1: 139,390,941 (GRCm39) T742I probably damaging Het
Bclaf3 A G X: 158,349,492 (GRCm39) H619R probably benign Het
Bltp2 T A 11: 78,179,123 (GRCm39) probably null Het
Cemip A T 7: 83,593,106 (GRCm39) L1199H probably damaging Het
Chd2 G A 7: 73,096,878 (GRCm39) probably benign Het
Clnk A G 5: 38,872,341 (GRCm39) Y310H probably damaging Het
Crmp1 A G 5: 37,441,484 (GRCm39) D522G probably damaging Het
Cyth3 A G 5: 143,622,298 (GRCm39) probably benign Het
Dcbld1 T A 10: 52,195,754 (GRCm39) Y392N probably damaging Het
Flnc T C 6: 29,454,056 (GRCm39) F1820L probably damaging Het
Galnt18 G A 7: 111,119,322 (GRCm39) R385* probably null Het
Gpatch3 C A 4: 133,302,479 (GRCm39) R137S possibly damaging Het
Gpc6 C T 14: 117,861,878 (GRCm39) P265S probably damaging Het
Harbi1 T A 2: 91,550,952 (GRCm39) D308E probably benign Het
Hdhd2 G A 18: 77,042,883 (GRCm39) probably null Het
Hk1 T C 10: 62,111,467 (GRCm39) K737E possibly damaging Het
Hnrnpr G A 4: 136,063,624 (GRCm39) V345M probably damaging Het
Ift56 T A 6: 38,380,459 (GRCm39) probably null Het
Kalrn T C 16: 34,040,610 (GRCm39) H944R probably damaging Het
Kdm2a A T 19: 4,401,833 (GRCm39) C207S probably damaging Het
Kirrel1 C T 3: 86,996,458 (GRCm39) M380I probably null Het
Krt75 C T 15: 101,481,956 (GRCm39) G104D possibly damaging Het
Lnpk A T 2: 74,352,607 (GRCm39) S358R probably benign Het
Map2 A G 1: 66,456,022 (GRCm39) T1512A probably damaging Het
Marchf10 T A 11: 105,287,905 (GRCm39) L132F probably damaging Het
Mfrp G A 9: 44,016,754 (GRCm39) W65* probably null Het
Mgat5 A G 1: 127,294,180 (GRCm39) D174G probably benign Het
Miga2 T A 2: 30,261,237 (GRCm39) Y177* probably null Het
Mroh3 T C 1: 136,113,213 (GRCm39) D747G probably damaging Het
Muc5b A G 7: 141,417,571 (GRCm39) T3506A possibly damaging Het
Myo7b G T 18: 32,107,165 (GRCm39) P1277T possibly damaging Het
Naaa C T 5: 92,420,413 (GRCm39) probably null Het
Ndufs2 T C 1: 171,062,889 (GRCm39) D410G possibly damaging Het
Or51a25 A G 7: 102,372,694 (GRCm39) probably null Het
Or5p78 T A 7: 108,212,280 (GRCm39) Y255* probably null Het
Or7e177 A G 9: 20,211,666 (GRCm39) I58V probably benign Het
Or8g35 A G 9: 39,381,365 (GRCm39) I219T probably benign Het
Osbp A T 19: 11,956,285 (GRCm39) Y409F probably benign Het
Plxnb1 T A 9: 108,938,355 (GRCm39) V1303D possibly damaging Het
Prkcg G A 7: 3,362,263 (GRCm39) D246N probably damaging Het
Ranbp17 GCCTGGATACTGACC GCC 11: 33,169,203 (GRCm39) probably benign Het
Sbf1 G A 15: 89,183,731 (GRCm39) R1261* probably null Het
Scn4a T C 11: 106,235,100 (GRCm39) N341S probably damaging Het
Sec61a2 C A 2: 5,884,436 (GRCm39) probably null Het
Sgcd T A 11: 47,246,032 (GRCm39) K57* probably null Het
Sinhcaf A G 6: 148,827,617 (GRCm39) S134P possibly damaging Het
Slc12a5 T C 2: 164,835,695 (GRCm39) L861P probably damaging Het
Slc6a16 A G 7: 44,909,386 (GRCm39) D184G probably benign Het
Snx7 A G 3: 117,632,639 (GRCm39) probably benign Het
Sptbn2 A G 19: 4,795,950 (GRCm39) I1710V probably damaging Het
Sytl2 A T 7: 90,025,289 (GRCm39) I426F probably benign Het
Tdp1 A G 12: 99,858,011 (GRCm39) probably benign Het
Tmem232 C A 17: 65,689,628 (GRCm39) D496Y possibly damaging Het
Tomm20l C T 12: 71,158,516 (GRCm39) A58V possibly damaging Het
Ttn T C 2: 76,775,618 (GRCm39) E1854G unknown Het
Ttn A G 2: 76,804,552 (GRCm39) V240A probably benign Het
Xrcc1 G C 7: 24,266,333 (GRCm39) A220P probably benign Het
Other mutations in Vmn2r98
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Vmn2r98 APN 17 19,286,007 (GRCm39) splice site probably benign
IGL01296:Vmn2r98 APN 17 19,285,447 (GRCm39) missense probably damaging 1.00
IGL01363:Vmn2r98 APN 17 19,286,020 (GRCm39) missense probably benign 0.01
IGL01618:Vmn2r98 APN 17 19,285,521 (GRCm39) missense possibly damaging 0.93
IGL01746:Vmn2r98 APN 17 19,286,713 (GRCm39) missense probably damaging 1.00
IGL01747:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01770:Vmn2r98 APN 17 19,286,702 (GRCm39) missense probably damaging 1.00
IGL01868:Vmn2r98 APN 17 19,286,548 (GRCm39) missense probably benign
IGL02123:Vmn2r98 APN 17 19,300,941 (GRCm39) missense probably damaging 1.00
IGL02323:Vmn2r98 APN 17 19,286,113 (GRCm39) missense probably damaging 0.99
IGL02543:Vmn2r98 APN 17 19,286,083 (GRCm39) missense probably benign
IGL02650:Vmn2r98 APN 17 19,301,223 (GRCm39) missense probably benign 0.00
IGL02676:Vmn2r98 APN 17 19,285,521 (GRCm39) missense probably benign 0.00
IGL02803:Vmn2r98 APN 17 19,286,275 (GRCm39) missense probably benign
IGL02807:Vmn2r98 APN 17 19,301,283 (GRCm39) missense probably damaging 1.00
IGL03307:Vmn2r98 APN 17 19,286,242 (GRCm39) missense possibly damaging 0.62
IGL03396:Vmn2r98 APN 17 19,290,107 (GRCm39) missense possibly damaging 0.92
PIT4131001:Vmn2r98 UTSW 17 19,301,223 (GRCm39) missense probably benign 0.00
R0122:Vmn2r98 UTSW 17 19,286,662 (GRCm39) missense probably benign 0.06
R0329:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0330:Vmn2r98 UTSW 17 19,286,609 (GRCm39) missense probably benign 0.21
R0368:Vmn2r98 UTSW 17 19,286,089 (GRCm39) nonsense probably null
R0545:Vmn2r98 UTSW 17 19,273,875 (GRCm39) missense probably benign 0.15
R0635:Vmn2r98 UTSW 17 19,300,759 (GRCm39) missense probably benign 0.00
R0689:Vmn2r98 UTSW 17 19,300,782 (GRCm39) missense possibly damaging 0.83
R1035:Vmn2r98 UTSW 17 19,301,011 (GRCm39) missense possibly damaging 0.90
R1243:Vmn2r98 UTSW 17 19,286,210 (GRCm39) missense possibly damaging 0.52
R1421:Vmn2r98 UTSW 17 19,285,440 (GRCm39) missense probably damaging 1.00
R1629:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R1643:Vmn2r98 UTSW 17 19,301,170 (GRCm39) missense probably damaging 1.00
R1795:Vmn2r98 UTSW 17 19,286,702 (GRCm39) missense probably damaging 1.00
R1958:Vmn2r98 UTSW 17 19,286,680 (GRCm39) missense possibly damaging 0.70
R1962:Vmn2r98 UTSW 17 19,285,595 (GRCm39) nonsense probably null
R2165:Vmn2r98 UTSW 17 19,301,553 (GRCm39) missense unknown
R2238:Vmn2r98 UTSW 17 19,286,213 (GRCm39) missense probably damaging 1.00
R2252:Vmn2r98 UTSW 17 19,300,698 (GRCm39) missense probably benign 0.00
R2323:Vmn2r98 UTSW 17 19,286,081 (GRCm39) missense probably benign 0.18
R2887:Vmn2r98 UTSW 17 19,301,439 (GRCm39) missense possibly damaging 0.83
R2909:Vmn2r98 UTSW 17 19,287,664 (GRCm39) missense probably damaging 1.00
R3001:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3002:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R3003:Vmn2r98 UTSW 17 19,286,125 (GRCm39) missense probably benign 0.01
R4570:Vmn2r98 UTSW 17 19,286,354 (GRCm39) missense probably benign 0.11
R4706:Vmn2r98 UTSW 17 19,290,007 (GRCm39) missense probably damaging 1.00
R4723:Vmn2r98 UTSW 17 19,286,602 (GRCm39) missense probably benign 0.01
R5036:Vmn2r98 UTSW 17 19,286,419 (GRCm39) missense probably benign 0.00
R5072:Vmn2r98 UTSW 17 19,286,306 (GRCm39) missense probably benign 0.07
R5121:Vmn2r98 UTSW 17 19,273,815 (GRCm39) missense probably benign 0.13
R5283:Vmn2r98 UTSW 17 19,300,981 (GRCm39) missense probably benign 0.05
R5294:Vmn2r98 UTSW 17 19,290,016 (GRCm39) nonsense probably null
R5371:Vmn2r98 UTSW 17 19,290,015 (GRCm39) missense probably damaging 1.00
R5532:Vmn2r98 UTSW 17 19,287,645 (GRCm39) missense possibly damaging 0.94
R5598:Vmn2r98 UTSW 17 19,301,161 (GRCm39) missense probably benign 0.37
R5800:Vmn2r98 UTSW 17 19,286,260 (GRCm39) missense probably benign 0.17
R6089:Vmn2r98 UTSW 17 19,286,336 (GRCm39) missense probably benign 0.29
R6155:Vmn2r98 UTSW 17 19,286,143 (GRCm39) missense possibly damaging 0.87
R6853:Vmn2r98 UTSW 17 19,286,063 (GRCm39) missense probably benign 0.00
R6920:Vmn2r98 UTSW 17 19,285,510 (GRCm39) missense probably damaging 0.98
R7012:Vmn2r98 UTSW 17 19,286,530 (GRCm39) missense probably benign 0.06
R7042:Vmn2r98 UTSW 17 19,301,184 (GRCm39) missense probably benign
R7068:Vmn2r98 UTSW 17 19,285,575 (GRCm39) missense probably benign
R7607:Vmn2r98 UTSW 17 19,287,570 (GRCm39) missense possibly damaging 0.95
R7763:Vmn2r98 UTSW 17 19,300,797 (GRCm39) missense probably benign 0.00
R7771:Vmn2r98 UTSW 17 19,287,460 (GRCm39) splice site probably null
R7915:Vmn2r98 UTSW 17 19,287,493 (GRCm39) missense probably benign 0.10
R8028:Vmn2r98 UTSW 17 19,273,912 (GRCm39) missense probably benign 0.00
R8205:Vmn2r98 UTSW 17 19,301,425 (GRCm39) missense probably damaging 0.99
R8241:Vmn2r98 UTSW 17 19,301,031 (GRCm39) missense probably damaging 0.99
R8906:Vmn2r98 UTSW 17 19,286,532 (GRCm39) missense probably benign
R8952:Vmn2r98 UTSW 17 19,285,531 (GRCm39) missense possibly damaging 0.76
R9147:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9148:Vmn2r98 UTSW 17 19,286,383 (GRCm39) missense probably benign 0.04
R9187:Vmn2r98 UTSW 17 19,301,481 (GRCm39) missense probably damaging 1.00
R9344:Vmn2r98 UTSW 17 19,286,777 (GRCm39) missense probably benign 0.14
R9467:Vmn2r98 UTSW 17 19,287,517 (GRCm39) missense probably benign 0.01
R9487:Vmn2r98 UTSW 17 19,301,496 (GRCm39) missense possibly damaging 0.78
R9753:Vmn2r98 UTSW 17 19,285,665 (GRCm39) missense probably benign 0.27
Z1177:Vmn2r98 UTSW 17 19,287,685 (GRCm39) nonsense probably null
Z1177:Vmn2r98 UTSW 17 19,285,398 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GACAAGTGTGTGAAATGTCCTG -3'
(R):5'- ACCATTCTCCCTGGAAAACTG -3'

Sequencing Primer
(F):5'- CTGCTTCCAAAAATCTGTGAGC -3'
(R):5'- CTCCCTGGAAAACTGATCTTAAAGG -3'
Posted On 2015-03-25