Mutagenetix > Incidental Mutations

Incidental Mutation 'R3788:Vmn2r98'

272405

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r98

Ensembl Gene

ENSMUSG00000096717

Gene Name

vomeronasal 2, receptor 98

Synonyms

EG224552

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.103) question?

Stock #

R3788 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19053460-19082411 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19080625 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Serine at position 630 (T630S)

Ref Sequence

ENSEMBL: ENSMUSP00000131261 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000170424]

Predicted Effect

probably benign
Transcript: ENSMUST00000170424
AA Change: T630S

PolyPhen 2 Score 0.312 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000131261
Gene: ENSMUSG00000096717
AA Change: T630S

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Pfam:ANF_receptor	82	460	2.6e-35	PFAM
Pfam:NCD3G	509	562	7.4e-22	PFAM
Pfam:7tm_3	594	830	1.4e-52	PFAM
low complexity region	844	856	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.1%

Validation Efficiency

100% (61/61)

Allele List at MGI

Other mutations in this stock

Total: 61 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	T	A	11: 78,288,297		probably null	Het
Abca4	T	A	3: 122,052,912	V26E	possibly damaging	Het
Abhd16a	A	G	17: 35,101,587	N411S	probably damaging	Het
Akap13	G	A	7: 75,702,153		probably null	Het
Aph1b	T	C	9: 66,794,066		probably benign	Het
Aspm	C	T	1: 139,463,203	T742I	probably damaging	Het
Bclaf3	A	G	X: 159,566,496	H619R	probably benign	Het
Cemip	A	T	7: 83,943,898	L1199H	probably damaging	Het
Chd2	G	A	7: 73,447,130		probably benign	Het
Clnk	A	G	5: 38,714,998	Y310H	probably damaging	Het
Crmp1	A	G	5: 37,284,140	D522G	probably damaging	Het
Cyth3	A	G	5: 143,636,543		probably benign	Het
Dcbld1	T	A	10: 52,319,658	Y392N	probably damaging	Het
Fam60a	A	G	6: 148,926,119	S134P	possibly damaging	Het
Flnc	T	C	6: 29,454,057	F1820L	probably damaging	Het
Galnt18	G	A	7: 111,520,115	R385*	probably null	Het
Gpatch3	C	A	4: 133,575,168	R137S	possibly damaging	Het
Gpc6	C	T	14: 117,624,466	P265S	probably damaging	Het
Harbi1	T	A	2: 91,720,607	D308E	probably benign	Het
Hdhd2	G	A	18: 76,955,187		probably null	Het
Hk1	T	C	10: 62,275,688	K737E	possibly damaging	Het
Hnrnpr	G	A	4: 136,336,313	V345M	probably damaging	Het
Kalrn	T	C	16: 34,220,240	H944R	probably damaging	Het
Kdm2a	A	T	19: 4,351,805	C207S	probably damaging	Het
Kirrel	C	T	3: 87,089,151	M380I	probably null	Het
Krt75	C	T	15: 101,573,521	G104D	possibly damaging	Het
Lnpk	A	T	2: 74,522,263	S358R	probably benign	Het
Map2	A	G	1: 66,416,863	T1512A	probably damaging	Het
March10	T	A	11: 105,397,079	L132F	probably damaging	Het
Mfrp	G	A	9: 44,105,457	W65*	probably null	Het
Mgat5	A	G	1: 127,366,443	D174G	probably benign	Het
Miga2	T	A	2: 30,371,225	Y177*	probably null	Het
Mroh3	T	C	1: 136,185,475	D747G	probably damaging	Het
Muc5b	A	G	7: 141,863,834	T3506A	possibly damaging	Het
Myo7b	G	T	18: 31,974,112	P1277T	possibly damaging	Het
Naaa	C	T	5: 92,272,554		probably null	Het
Ndufs2	T	C	1: 171,235,320	D410G	possibly damaging	Het
Olfr506	T	A	7: 108,613,073	Y255*	probably null	Het
Olfr559	A	G	7: 102,723,487		probably null	Het
Olfr873	A	G	9: 20,300,370	I58V	probably benign	Het
Olfr955	A	G	9: 39,470,069	I219T	probably benign	Het
Osbp	A	T	19: 11,978,921	Y409F	probably benign	Het
Plxnb1	T	A	9: 109,109,287	V1303D	possibly damaging	Het
Prkcg	G	A	7: 3,313,747	D246N	probably damaging	Het
Ranbp17	GCCTGGATACTGACC	GCC	11: 33,219,203		probably benign	Het
Sbf1	G	A	15: 89,299,528	R1261*	probably null	Het
Scn4a	T	C	11: 106,344,274	N341S	probably damaging	Het
Sec61a2	C	A	2: 5,879,625		probably null	Het
Sgcd	T	A	11: 47,355,205	K57*	probably null	Het
Slc12a5	T	C	2: 164,993,775	L861P	probably damaging	Het
Slc6a16	A	G	7: 45,259,962	D184G	probably benign	Het
Snx7	A	G	3: 117,838,990		probably benign	Het
Sptbn2	A	G	19: 4,745,922	I1710V	probably damaging	Het
Sytl2	A	T	7: 90,376,081	I426F	probably benign	Het
Tdp1	A	G	12: 99,891,752		probably benign	Het
Tmem232	C	A	17: 65,382,633	D496Y	possibly damaging	Het
Tomm20l	C	T	12: 71,111,742	A58V	possibly damaging	Het
Ttc26	T	A	6: 38,403,524		probably null	Het
Ttn	T	C	2: 76,945,274	E1854G	unknown	Het
Ttn	A	G	2: 76,974,208	V240A	probably benign	Het
Xrcc1	G	C	7: 24,566,908	A220P	probably benign	Het

Other mutations in Vmn2r98

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Vmn2r98	APN	17	19065745	splice site	probably benign
IGL01296:Vmn2r98	APN	17	19065185	missense	probably damaging	1.00
IGL01363:Vmn2r98	APN	17	19065758	missense	probably benign	0.01
IGL01618:Vmn2r98	APN	17	19065259	missense	possibly damaging	0.93
IGL01746:Vmn2r98	APN	17	19066451	missense	probably damaging	1.00
IGL01747:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01770:Vmn2r98	APN	17	19066440	missense	probably damaging	1.00
IGL01868:Vmn2r98	APN	17	19066286	missense	probably benign
IGL02123:Vmn2r98	APN	17	19080679	missense	probably damaging	1.00
IGL02323:Vmn2r98	APN	17	19065851	missense	probably damaging	0.99
IGL02543:Vmn2r98	APN	17	19065821	missense	probably benign
IGL02650:Vmn2r98	APN	17	19080961	missense	probably benign	0.00
IGL02676:Vmn2r98	APN	17	19065259	missense	probably benign	0.00
IGL02803:Vmn2r98	APN	17	19066013	missense	probably benign
IGL02807:Vmn2r98	APN	17	19081021	missense	probably damaging	1.00
IGL03307:Vmn2r98	APN	17	19065980	missense	possibly damaging	0.62
IGL03396:Vmn2r98	APN	17	19069845	missense	possibly damaging	0.92
PIT4131001:Vmn2r98	UTSW	17	19080961	missense	probably benign	0.00
R0122:Vmn2r98	UTSW	17	19066400	missense	probably benign	0.06
R0329:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0330:Vmn2r98	UTSW	17	19066347	missense	probably benign	0.21
R0368:Vmn2r98	UTSW	17	19065827	nonsense	probably null
R0545:Vmn2r98	UTSW	17	19053613	missense	probably benign	0.15
R0635:Vmn2r98	UTSW	17	19080497	missense	probably benign	0.00
R0689:Vmn2r98	UTSW	17	19080520	missense	possibly damaging	0.83
R1035:Vmn2r98	UTSW	17	19080749	missense	possibly damaging	0.90
R1243:Vmn2r98	UTSW	17	19065948	missense	possibly damaging	0.52
R1421:Vmn2r98	UTSW	17	19065178	missense	probably damaging	1.00
R1629:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R1643:Vmn2r98	UTSW	17	19080908	missense	probably damaging	1.00
R1795:Vmn2r98	UTSW	17	19066440	missense	probably damaging	1.00
R1958:Vmn2r98	UTSW	17	19066418	missense	possibly damaging	0.70
R1962:Vmn2r98	UTSW	17	19065333	nonsense	probably null
R2165:Vmn2r98	UTSW	17	19081291	missense	unknown
R2238:Vmn2r98	UTSW	17	19065951	missense	probably damaging	1.00
R2252:Vmn2r98	UTSW	17	19080436	missense	probably benign	0.00
R2323:Vmn2r98	UTSW	17	19065819	missense	probably benign	0.18
R2887:Vmn2r98	UTSW	17	19081177	missense	possibly damaging	0.83
R2909:Vmn2r98	UTSW	17	19067402	missense	probably damaging	1.00
R3001:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3002:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R3003:Vmn2r98	UTSW	17	19065863	missense	probably benign	0.01
R4570:Vmn2r98	UTSW	17	19066092	missense	probably benign	0.11
R4706:Vmn2r98	UTSW	17	19069745	missense	probably damaging	1.00
R4723:Vmn2r98	UTSW	17	19066340	missense	probably benign	0.01
R5036:Vmn2r98	UTSW	17	19066157	missense	probably benign	0.00
R5072:Vmn2r98	UTSW	17	19066044	missense	probably benign	0.07
R5121:Vmn2r98	UTSW	17	19053553	missense	probably benign	0.13
R5283:Vmn2r98	UTSW	17	19080719	missense	probably benign	0.05
R5294:Vmn2r98	UTSW	17	19069754	nonsense	probably null
R5371:Vmn2r98	UTSW	17	19069753	missense	probably damaging	1.00
R5532:Vmn2r98	UTSW	17	19067383	missense	possibly damaging	0.94
R5598:Vmn2r98	UTSW	17	19080899	missense	probably benign	0.37
R5800:Vmn2r98	UTSW	17	19065998	missense	probably benign	0.17
R6089:Vmn2r98	UTSW	17	19066074	missense	probably benign	0.29
R6155:Vmn2r98	UTSW	17	19065881	missense	possibly damaging	0.87
R6853:Vmn2r98	UTSW	17	19065801	missense	probably benign	0.00
R6920:Vmn2r98	UTSW	17	19065248	missense	probably damaging	0.98
R7012:Vmn2r98	UTSW	17	19066268	missense	probably benign	0.06
R7042:Vmn2r98	UTSW	17	19080922	missense	probably benign
R7068:Vmn2r98	UTSW	17	19065313	missense	probably benign
R7607:Vmn2r98	UTSW	17	19067308	missense	possibly damaging	0.95
R7763:Vmn2r98	UTSW	17	19080535	missense	probably benign	0.00
R7771:Vmn2r98	UTSW	17	19067198	splice site	probably null
R8028:Vmn2r98	UTSW	17	19053650	missense	probably benign	0.00
R8205:Vmn2r98	UTSW	17	19081163	missense	probably damaging	0.99
R8241:Vmn2r98	UTSW	17	19080769	missense	probably damaging	0.99
Z1177:Vmn2r98	UTSW	17	19065136	critical splice acceptor site	probably null
Z1177:Vmn2r98	UTSW	17	19067423	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GACAAGTGTGTGAAATGTCCTG -3'
(R):5'- ACCATTCTCCCTGGAAAACTG -3'

Sequencing Primer
(F):5'- CTGCTTCCAAAAATCTGTGAGC -3'
(R):5'- CTCCCTGGAAAACTGATCTTAAAGG -3'

Posted On

2015-03-25