Incidental Mutation 'R3836:Nprl3'
ID 275658
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 040891-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R3836 (G1)
Quality Score 143
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 32183082 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 502 (E502K)
Ref Sequence ENSEMBL: ENSMUSP00000105016 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020528] [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000142964] [ENSMUST00000137950] [ENSMUST00000138050] [ENSMUST00000141859] [ENSMUST00000136903]
AlphaFold Q8VIJ8
Predicted Effect probably benign
Transcript: ENSMUST00000020528
SMART Domains Protein: ENSMUSP00000020528
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
Pfam:Pur_DNA_glyco 109 304 1.2e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020530
AA Change: E527K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: E527K

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109389
AA Change: E502K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: E502K

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125256
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148636
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129573
Predicted Effect probably benign
Transcript: ENSMUST00000142964
SMART Domains Protein: ENSMUSP00000118208
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000138050
SMART Domains Protein: ENSMUSP00000121960
Gene: ENSMUSG00000020287

DomainStartEndE-ValueType
low complexity region 2 14 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
SCOP:d1ewna_ 102 125 5e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Meta Mutation Damage Score 0.7734 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,648,219 (GRCm39) noncoding transcript Het
Aasdh A G 5: 77,026,315 (GRCm39) V903A probably benign Het
Afg2a T A 3: 37,487,792 (GRCm39) Y428N possibly damaging Het
Ankrd6 T A 4: 32,817,531 (GRCm39) D271V probably damaging Het
Ano10 C T 9: 122,092,829 (GRCm39) V167M possibly damaging Het
Arhgef25 T C 10: 127,025,605 (GRCm39) T12A probably benign Het
AW551984 T C 9: 39,509,204 (GRCm39) probably benign Het
Bub1 G T 2: 127,656,806 (GRCm39) P442Q probably damaging Het
Clstn1 A G 4: 149,722,790 (GRCm39) E476G probably damaging Het
Comp A G 8: 70,826,509 (GRCm39) D28G probably benign Het
Crym A G 7: 119,800,439 (GRCm39) V61A probably benign Het
Dock4 G T 12: 40,844,623 (GRCm39) probably null Het
Dtna A T 18: 23,758,159 (GRCm39) Q488L probably damaging Het
Ecel1 A C 1: 87,078,378 (GRCm39) L565R probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Fam13c C T 10: 70,378,478 (GRCm39) S336L probably damaging Het
Fnbp4 A G 2: 90,577,129 (GRCm39) T154A probably damaging Het
Fsip2 T C 2: 82,781,290 (GRCm39) L32P probably damaging Het
Gldc T A 19: 30,096,075 (GRCm39) probably benign Het
Gm12695 T G 4: 96,650,334 (GRCm39) T171P probably damaging Het
Gm4868 A C 5: 125,925,014 (GRCm39) noncoding transcript Het
Gpam T C 19: 55,068,890 (GRCm39) N450S probably benign Het
Gstm5 T C 3: 107,803,678 (GRCm39) I37T probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Itga11 G T 9: 62,676,565 (GRCm39) V918L probably benign Het
Itgb2l T A 16: 96,227,367 (GRCm39) M559L probably benign Het
Itih1 T A 14: 30,657,785 (GRCm39) N429Y probably damaging Het
Madd A T 2: 90,984,988 (GRCm39) probably null Het
Map3k11 A G 19: 5,740,831 (GRCm39) E186G possibly damaging Het
Mbl2 T C 19: 30,216,914 (GRCm39) F242S probably damaging Het
Mcph1 A G 8: 18,672,675 (GRCm39) T102A possibly damaging Het
Mid1ip1 T C X: 10,584,620 (GRCm39) V51A possibly damaging Het
Mkln1 A G 6: 31,445,271 (GRCm39) D389G probably damaging Het
Mmrn1 G A 6: 60,921,831 (GRCm39) S96N probably benign Het
Myd88 A G 9: 119,167,259 (GRCm39) probably benign Het
Nap1l1 T A 10: 111,331,183 (GRCm39) probably null Het
Nudt5 T A 2: 5,871,158 (GRCm39) probably null Het
Or52b2 G A 7: 104,986,417 (GRCm39) P169S probably benign Het
Or5h23 A G 16: 58,906,586 (GRCm39) S87P possibly damaging Het
Or6c69b C T 10: 129,627,039 (GRCm39) V140M probably benign Het
Or8j3 A G 2: 86,029,006 (GRCm39) V30A probably benign Het
Plaa T C 4: 94,475,159 (GRCm39) probably null Het
Ptk2b A G 14: 66,393,791 (GRCm39) L894P probably damaging Het
Rab8b A G 9: 66,755,078 (GRCm39) S183P probably benign Het
Reln A G 5: 22,116,012 (GRCm39) Y2999H probably damaging Het
Rims4 A G 2: 163,760,573 (GRCm39) S11P possibly damaging Het
Scel A G 14: 103,829,822 (GRCm39) K448R possibly damaging Het
Serpinb10 A T 1: 107,463,816 (GRCm39) T33S probably benign Het
Sgip1 A G 4: 102,724,897 (GRCm39) probably null Het
Sv2b A T 7: 74,807,176 (GRCm39) M158K probably damaging Het
Tmem132d A T 5: 127,861,949 (GRCm39) I724N probably damaging Het
Tnrc6c A G 11: 117,614,055 (GRCm39) T738A probably benign Het
Tpbg T C 9: 85,725,167 (GRCm39) probably benign Het
Tubb2a G T 13: 34,259,294 (GRCm39) N165K probably benign Het
Ubtfl1 A T 9: 18,320,533 (GRCm39) E20D possibly damaging Het
Usp14 A G 18: 10,024,532 (GRCm39) probably null Het
Vmn2r25 C A 6: 123,830,044 (GRCm39) D36Y probably damaging Het
Wdhd1 A G 14: 47,482,511 (GRCm39) V946A probably benign Het
Wnk1 T C 6: 119,927,004 (GRCm39) E1265G probably damaging Het
Zmynd8 G A 2: 165,700,019 (GRCm39) T14I probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6052:Nprl3 UTSW 11 32,205,453 (GRCm39) missense possibly damaging 0.92
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAAGGGAGGTTGTTTCCATC -3'
(R):5'- GCTCTGTGGACTCTTTAGGC -3'

Sequencing Primer
(F):5'- AGGGAGGTTGTTTCCATCCACAC -3'
(R):5'- TCCACCATCTGTCACTGGGG -3'
Posted On 2015-04-06