Incidental Mutation 'R6052:Nprl3'
ID 484174
Institutional Source Beutler Lab
Gene Symbol Nprl3
Ensembl Gene ENSMUSG00000020289
Gene Name nitrogen permease regulator-like 3
Synonyms Mare, HS-26, Prox1, Phg, -14 gene, HS-40, m(alpha)RE
MMRRC Submission 044220-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.224) question?
Stock # R6052 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 32181963-32217707 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 32205453 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 102 (H102N)
Ref Sequence ENSEMBL: ENSMUSP00000020530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020530] [ENSMUST00000109389] [ENSMUST00000124640] [ENSMUST00000129010] [ENSMUST00000136903] [ENSMUST00000137950] [ENSMUST00000141859] [ENSMUST00000149526]
AlphaFold Q8VIJ8
Predicted Effect possibly damaging
Transcript: ENSMUST00000020530
AA Change: H102N

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000020530
Gene: ENSMUSG00000020289
AA Change: H102N

DomainStartEndE-ValueType
Blast:DSPc 1 77 3e-27 BLAST
Pfam:NPR3 104 418 1.8e-44 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000109389
AA Change: H102N

PolyPhen 2 Score 0.847 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105016
Gene: ENSMUSG00000020289
AA Change: H102N

DomainStartEndE-ValueType
Pfam:NPR3 63 108 8.3e-15 PFAM
Pfam:NPR3 104 395 3.1e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000109390
Predicted Effect probably benign
Transcript: ENSMUST00000124640
SMART Domains Protein: ENSMUSP00000122085
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000129010
AA Change: H115N

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123219
Gene: ENSMUSG00000020289
AA Change: H115N

DomainStartEndE-ValueType
Blast:DSPc 1 59 3e-29 BLAST
Pfam:NPR3 76 131 3e-16 PFAM
Pfam:NPR3 114 182 3.7e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136903
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146890
Predicted Effect probably benign
Transcript: ENSMUST00000137950
SMART Domains Protein: ENSMUSP00000115594
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 68 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141859
SMART Domains Protein: ENSMUSP00000120341
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Blast:DSPc 1 59 2e-30 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000149526
SMART Domains Protein: ENSMUSP00000122231
Gene: ENSMUSG00000020289

DomainStartEndE-ValueType
Pfam:NPR3 8 72 2.7e-14 PFAM
Meta Mutation Damage Score 0.1234 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.7%
Validation Efficiency 96% (80/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The function of the encoded protein is not known. [provided by RefSeq, Aug 2011]
PHENOTYPE: This gene is deleted in the Hbath-J mutation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 A G 17: 24,537,165 (GRCm39) F473L probably benign Het
Ankrd17 T C 5: 90,401,691 (GRCm39) I1449V probably benign Het
Aox4 T A 1: 58,293,477 (GRCm39) L943* probably null Het
Arap1 G A 7: 101,053,240 (GRCm39) V1257M probably damaging Het
B3gnt9 T C 8: 105,981,230 (GRCm39) S53G probably benign Het
Baiap3 A T 17: 25,467,444 (GRCm39) probably benign Het
Canx T C 11: 50,187,946 (GRCm39) D554G possibly damaging Het
Cbfa2t2 T C 2: 154,352,501 (GRCm39) V165A probably damaging Het
Ccdc17 C T 4: 116,457,145 (GRCm39) probably null Het
Cdcp1 A G 9: 123,014,396 (GRCm39) I126T probably benign Het
Cdk13 A T 13: 17,895,800 (GRCm39) D1036E probably damaging Het
Cfap157 A G 2: 32,669,863 (GRCm39) L240P probably damaging Het
Clec18a C A 8: 111,805,448 (GRCm39) E218* probably null Het
Col3a1 T C 1: 45,384,173 (GRCm39) probably benign Het
Dennd4a A G 9: 64,794,227 (GRCm39) E682G probably damaging Het
Dnah14 T C 1: 181,494,052 (GRCm39) V1736A possibly damaging Het
Dpep2 T A 8: 106,717,270 (GRCm39) D162V possibly damaging Het
Drd3 C A 16: 43,641,646 (GRCm39) P321T probably benign Het
Egfr A G 11: 16,861,554 (GRCm39) H1111R probably benign Het
Entpd1 T C 19: 40,708,928 (GRCm39) S58P probably damaging Het
Epha3 C A 16: 63,423,967 (GRCm39) V541L possibly damaging Het
Eri3 T A 4: 117,421,825 (GRCm39) D34E probably damaging Het
Eya1 T C 1: 14,353,374 (GRCm39) D58G probably damaging Het
Fat3 T A 9: 15,833,975 (GRCm39) S26C probably null Het
Fgl1 T C 8: 41,653,548 (GRCm39) D115G probably damaging Het
Fitm2 T C 2: 163,312,036 (GRCm39) Y59C probably damaging Het
Fras1 T A 5: 96,912,725 (GRCm39) I3343N probably damaging Het
Gba2 C A 4: 43,568,330 (GRCm39) C679F probably damaging Het
Glis2 G A 16: 4,431,603 (GRCm39) probably benign Het
Gm5150 T A 3: 16,044,917 (GRCm39) I103F probably damaging Het
Hhipl2 T C 1: 183,204,965 (GRCm39) S313P possibly damaging Het
Hmgcs1 A G 13: 120,166,995 (GRCm39) D474G probably benign Het
Homer3 C T 8: 70,744,076 (GRCm39) Q267* probably null Het
Hsd17b8 A G 17: 34,246,429 (GRCm39) L118P probably damaging Het
Igkv8-28 C T 6: 70,120,673 (GRCm39) G90D probably damaging Het
Kalrn T A 16: 34,181,255 (GRCm39) I128F probably damaging Het
Krt4 A G 15: 101,831,194 (GRCm39) probably null Het
Lamb2 T A 9: 108,364,811 (GRCm39) C1188* probably null Het
Lsr A T 7: 30,658,042 (GRCm39) M355K probably damaging Het
Map3k11 T G 19: 5,747,430 (GRCm39) D555E probably benign Het
Myocd A G 11: 65,087,082 (GRCm39) Y282H probably damaging Het
Nae1 T C 8: 105,261,176 (GRCm39) I7M probably benign Het
Nup62 T A 7: 44,478,464 (GRCm39) F160I possibly damaging Het
Or10w1 C A 19: 13,631,871 (GRCm39) P26Q possibly damaging Het
Or2d3c A T 7: 106,525,896 (GRCm39) F257I probably benign Het
Or2r2 T A 6: 42,463,588 (GRCm39) T180S possibly damaging Het
Or5p76 A G 7: 108,122,945 (GRCm39) S71P probably benign Het
Or6c35 C A 10: 129,169,071 (GRCm39) T107K possibly damaging Het
Osbpl10 T C 9: 114,896,383 (GRCm39) probably null Het
Pcdh9 C T 14: 94,123,282 (GRCm39) V963I probably benign Het
Phf12 A G 11: 77,909,044 (GRCm39) R375G probably benign Het
Piezo1 G A 8: 123,233,008 (GRCm39) T108M probably damaging Het
Plxnc1 T A 10: 94,779,635 (GRCm39) Q269L probably benign Het
Pomgnt1 T A 4: 116,008,799 (GRCm39) N11K possibly damaging Het
Pramel22 T A 4: 143,382,222 (GRCm39) D158V probably damaging Het
Prkd1 A T 12: 50,413,083 (GRCm39) probably null Het
Prpf40a T C 2: 53,049,293 (GRCm39) T190A probably benign Het
Prrc2b A C 2: 32,102,297 (GRCm39) H790P possibly damaging Het
Rest T G 5: 77,429,027 (GRCm39) V482G probably benign Het
Ros1 T A 10: 52,039,999 (GRCm39) I322L probably benign Het
Rpl18 G A 7: 45,369,554 (GRCm39) probably benign Het
Rsad2 G A 12: 26,500,577 (GRCm39) H237Y probably benign Het
Sbf2 A G 7: 110,040,741 (GRCm39) L362S probably damaging Het
Sgsm3 A G 15: 80,893,464 (GRCm39) T409A probably benign Het
Slc16a14 T C 1: 84,890,430 (GRCm39) T292A possibly damaging Het
Spg11 T G 2: 121,927,837 (GRCm39) K649T probably damaging Het
Srprb T A 9: 103,067,415 (GRCm39) I268F possibly damaging Het
Tap2 G A 17: 34,433,683 (GRCm39) G566S probably damaging Het
Tecpr2 T C 12: 110,885,325 (GRCm39) V168A possibly damaging Het
Tln1 G C 4: 43,555,052 (GRCm39) F259L probably damaging Het
Tmem181a T A 17: 6,330,890 (GRCm39) L50H probably damaging Het
Tshz1 A G 18: 84,032,194 (GRCm39) I738T probably damaging Het
Tspan12 T C 6: 21,772,637 (GRCm39) E304G probably benign Het
Urb1 C T 16: 90,559,271 (GRCm39) G1671S probably damaging Het
Vmn2r2 T C 3: 64,024,782 (GRCm39) S600G possibly damaging Het
Wnt3 C A 11: 103,699,000 (GRCm39) Y35* probably null Het
Xpo7 T C 14: 70,921,159 (GRCm39) Y603C possibly damaging Het
Zfp457 G A 13: 67,442,015 (GRCm39) H91Y probably damaging Het
Zfp664 T A 5: 124,963,250 (GRCm39) C215S unknown Het
Zfp882 G A 8: 72,668,349 (GRCm39) G392D probably benign Het
Other mutations in Nprl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02410:Nprl3 APN 11 32,217,539 (GRCm39) start codon destroyed probably null 0.99
IGL03055:Nprl3 APN 11 32,198,230 (GRCm39) intron probably benign
IGL03366:Nprl3 APN 11 32,200,256 (GRCm39) missense probably damaging 1.00
R0114:Nprl3 UTSW 11 32,189,784 (GRCm39) unclassified probably benign
R0555:Nprl3 UTSW 11 32,183,118 (GRCm39) critical splice acceptor site probably null
R0620:Nprl3 UTSW 11 32,184,876 (GRCm39) missense probably damaging 1.00
R2008:Nprl3 UTSW 11 32,182,973 (GRCm39) missense probably damaging 0.97
R2172:Nprl3 UTSW 11 32,184,894 (GRCm39) missense probably benign 0.00
R2884:Nprl3 UTSW 11 32,198,163 (GRCm39) missense probably damaging 1.00
R3713:Nprl3 UTSW 11 32,205,464 (GRCm39) missense probably damaging 0.98
R3836:Nprl3 UTSW 11 32,183,082 (GRCm39) missense probably damaging 1.00
R4354:Nprl3 UTSW 11 32,184,906 (GRCm39) missense probably benign 0.00
R6056:Nprl3 UTSW 11 32,217,432 (GRCm39) missense probably damaging 0.98
R6307:Nprl3 UTSW 11 32,189,828 (GRCm39) missense probably damaging 1.00
R6553:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6585:Nprl3 UTSW 11 32,184,812 (GRCm39) missense probably benign
R6774:Nprl3 UTSW 11 32,187,381 (GRCm39) missense probably damaging 1.00
R6806:Nprl3 UTSW 11 32,217,509 (GRCm39) missense probably damaging 0.99
R7746:Nprl3 UTSW 11 32,198,150 (GRCm39) nonsense probably null
R7980:Nprl3 UTSW 11 32,187,357 (GRCm39) missense probably damaging 1.00
R8483:Nprl3 UTSW 11 32,213,083 (GRCm39) missense probably damaging 1.00
R8712:Nprl3 UTSW 11 32,187,334 (GRCm39) missense possibly damaging 0.84
R8827:Nprl3 UTSW 11 32,184,742 (GRCm39) missense probably benign 0.00
R9264:Nprl3 UTSW 11 32,183,948 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TAATGCCCTGGTCCTAGGAAG -3'
(R):5'- AGAACTGTCATTTCCTGAGCC -3'

Sequencing Primer
(F):5'- TCCTAGGAAGGCGTACAGC -3'
(R):5'- GAGCCACTCCCCACTTGTG -3'
Posted On 2017-07-14