Incidental Mutation 'R3836:Aasdh'
ID 275633
Institutional Source Beutler Lab
Gene Symbol Aasdh
Ensembl Gene ENSMUSG00000055923
Gene Name aminoadipate-semialdehyde dehydrogenase
Synonyms A230062G08Rik
MMRRC Submission 040891-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.159) question?
Stock # R3836 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 77021506-77053361 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 77026315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 903 (V903A)
Ref Sequence ENSEMBL: ENSMUSP00000113792 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069709] [ENSMUST00000120639] [ENSMUST00000120963] [ENSMUST00000123682] [ENSMUST00000126741] [ENSMUST00000149602] [ENSMUST00000146570] [ENSMUST00000163347]
AlphaFold Q80WC9
Predicted Effect probably benign
Transcript: ENSMUST00000069709
AA Change: V903A

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000069279
Gene: ENSMUSG00000055923
AA Change: V903A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000120639
SMART Domains Protein: ENSMUSP00000113796
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120963
AA Change: V903A

PolyPhen 2 Score 0.321 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000113792
Gene: ENSMUSG00000055923
AA Change: V903A

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 1.3e-50 PFAM
Pfam:AMP-binding_C 458 526 7.4e-6 PFAM
Pfam:PP-binding 556 628 1.2e-6 PFAM
PQQ 775 808 5.29e-1 SMART
PQQ 818 850 4.37e-2 SMART
PQQ 860 892 2.3e1 SMART
PQQ 901 934 2.83e1 SMART
Blast:PQQ 943 973 2e-9 BLAST
PQQ 982 1014 2.61e2 SMART
PQQ 1029 1061 8.53e0 SMART
Blast:PQQ 1070 1100 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123059
Predicted Effect probably benign
Transcript: ENSMUST00000123682
SMART Domains Protein: ENSMUSP00000121050
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 231 1.7e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126741
SMART Domains Protein: ENSMUSP00000118854
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 403 7.5e-51 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149602
AA Change: V106A

PolyPhen 2 Score 0.086 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000117489
Gene: ENSMUSG00000055923
AA Change: V106A

DomainStartEndE-ValueType
PQQ 21 53 4.37e-2 SMART
PQQ 63 95 2.3e1 SMART
Blast:PQQ 104 130 2e-6 BLAST
PQQ 141 173 2.61e2 SMART
low complexity region 191 200 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145022
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135697
Predicted Effect probably benign
Transcript: ENSMUST00000146570
SMART Domains Protein: ENSMUSP00000117639
Gene: ENSMUSG00000055923

DomainStartEndE-ValueType
Pfam:AMP-binding 7 449 2.1e-58 PFAM
Pfam:PP-binding 556 628 1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163347
SMART Domains Protein: ENSMUSP00000127212
Gene: ENSMUSG00000036377

DomainStartEndE-ValueType
Pfam:DUF4592 44 173 1.7e-45 PFAM
low complexity region 210 220 N/A INTRINSIC
coiled coil region 224 291 N/A INTRINSIC
coiled coil region 328 482 N/A INTRINSIC
low complexity region 533 547 N/A INTRINSIC
low complexity region 580 593 N/A INTRINSIC
low complexity region 875 888 N/A INTRINSIC
internal_repeat_1 947 1025 1.47e-5 PROSPERO
low complexity region 1034 1047 N/A INTRINSIC
internal_repeat_1 1065 1122 1.47e-5 PROSPERO
low complexity region 1268 1280 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: The gene product is a cytosolic enzyme involved in the production of alpha-aminoadipic acid from alpha-aminoadipic semialdehyde. It is postulated that this enzyme plays a role in lysine metabolism. There is currently debate regarding this enzyme's putative requirement of pyrroloquinoline quinine as an essential cofactor. A related pseudogene has been identified on chromosome 2. [provided by RefSeq, Jan 2010]
Allele List at MGI

All alleles(14) : Gene trapped(14)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028I16Rik A G 10: 82,648,219 (GRCm39) noncoding transcript Het
Afg2a T A 3: 37,487,792 (GRCm39) Y428N possibly damaging Het
Ankrd6 T A 4: 32,817,531 (GRCm39) D271V probably damaging Het
Ano10 C T 9: 122,092,829 (GRCm39) V167M possibly damaging Het
Arhgef25 T C 10: 127,025,605 (GRCm39) T12A probably benign Het
AW551984 T C 9: 39,509,204 (GRCm39) probably benign Het
Bub1 G T 2: 127,656,806 (GRCm39) P442Q probably damaging Het
Clstn1 A G 4: 149,722,790 (GRCm39) E476G probably damaging Het
Comp A G 8: 70,826,509 (GRCm39) D28G probably benign Het
Crym A G 7: 119,800,439 (GRCm39) V61A probably benign Het
Dock4 G T 12: 40,844,623 (GRCm39) probably null Het
Dtna A T 18: 23,758,159 (GRCm39) Q488L probably damaging Het
Ecel1 A C 1: 87,078,378 (GRCm39) L565R probably damaging Het
Extl2 T C 3: 115,818,006 (GRCm39) I106T probably benign Het
Fam13c C T 10: 70,378,478 (GRCm39) S336L probably damaging Het
Fnbp4 A G 2: 90,577,129 (GRCm39) T154A probably damaging Het
Fsip2 T C 2: 82,781,290 (GRCm39) L32P probably damaging Het
Gldc T A 19: 30,096,075 (GRCm39) probably benign Het
Gm12695 T G 4: 96,650,334 (GRCm39) T171P probably damaging Het
Gm4868 A C 5: 125,925,014 (GRCm39) noncoding transcript Het
Gpam T C 19: 55,068,890 (GRCm39) N450S probably benign Het
Gstm5 T C 3: 107,803,678 (GRCm39) I37T probably benign Het
Hivep2 C A 10: 14,004,713 (GRCm39) T437K probably benign Het
Itga11 G T 9: 62,676,565 (GRCm39) V918L probably benign Het
Itgb2l T A 16: 96,227,367 (GRCm39) M559L probably benign Het
Itih1 T A 14: 30,657,785 (GRCm39) N429Y probably damaging Het
Madd A T 2: 90,984,988 (GRCm39) probably null Het
Map3k11 A G 19: 5,740,831 (GRCm39) E186G possibly damaging Het
Mbl2 T C 19: 30,216,914 (GRCm39) F242S probably damaging Het
Mcph1 A G 8: 18,672,675 (GRCm39) T102A possibly damaging Het
Mid1ip1 T C X: 10,584,620 (GRCm39) V51A possibly damaging Het
Mkln1 A G 6: 31,445,271 (GRCm39) D389G probably damaging Het
Mmrn1 G A 6: 60,921,831 (GRCm39) S96N probably benign Het
Myd88 A G 9: 119,167,259 (GRCm39) probably benign Het
Nap1l1 T A 10: 111,331,183 (GRCm39) probably null Het
Nprl3 C T 11: 32,183,082 (GRCm39) E502K probably damaging Het
Nudt5 T A 2: 5,871,158 (GRCm39) probably null Het
Or52b2 G A 7: 104,986,417 (GRCm39) P169S probably benign Het
Or5h23 A G 16: 58,906,586 (GRCm39) S87P possibly damaging Het
Or6c69b C T 10: 129,627,039 (GRCm39) V140M probably benign Het
Or8j3 A G 2: 86,029,006 (GRCm39) V30A probably benign Het
Plaa T C 4: 94,475,159 (GRCm39) probably null Het
Ptk2b A G 14: 66,393,791 (GRCm39) L894P probably damaging Het
Rab8b A G 9: 66,755,078 (GRCm39) S183P probably benign Het
Reln A G 5: 22,116,012 (GRCm39) Y2999H probably damaging Het
Rims4 A G 2: 163,760,573 (GRCm39) S11P possibly damaging Het
Scel A G 14: 103,829,822 (GRCm39) K448R possibly damaging Het
Serpinb10 A T 1: 107,463,816 (GRCm39) T33S probably benign Het
Sgip1 A G 4: 102,724,897 (GRCm39) probably null Het
Sv2b A T 7: 74,807,176 (GRCm39) M158K probably damaging Het
Tmem132d A T 5: 127,861,949 (GRCm39) I724N probably damaging Het
Tnrc6c A G 11: 117,614,055 (GRCm39) T738A probably benign Het
Tpbg T C 9: 85,725,167 (GRCm39) probably benign Het
Tubb2a G T 13: 34,259,294 (GRCm39) N165K probably benign Het
Ubtfl1 A T 9: 18,320,533 (GRCm39) E20D possibly damaging Het
Usp14 A G 18: 10,024,532 (GRCm39) probably null Het
Vmn2r25 C A 6: 123,830,044 (GRCm39) D36Y probably damaging Het
Wdhd1 A G 14: 47,482,511 (GRCm39) V946A probably benign Het
Wnk1 T C 6: 119,927,004 (GRCm39) E1265G probably damaging Het
Zmynd8 G A 2: 165,700,019 (GRCm39) T14I probably benign Het
Other mutations in Aasdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00823:Aasdh APN 5 77,026,381 (GRCm39) unclassified probably benign
IGL01013:Aasdh APN 5 77,034,053 (GRCm39) missense possibly damaging 0.68
IGL01558:Aasdh APN 5 77,036,464 (GRCm39) missense possibly damaging 0.89
IGL02544:Aasdh APN 5 77,049,961 (GRCm39) missense probably benign 0.27
IGL02614:Aasdh APN 5 77,044,215 (GRCm39) splice site probably benign
IGL02678:Aasdh APN 5 77,035,867 (GRCm39) splice site probably benign
IGL02739:Aasdh APN 5 77,026,364 (GRCm39) missense possibly damaging 0.64
IGL02947:Aasdh APN 5 77,049,957 (GRCm39) missense probably benign 0.01
IGL03116:Aasdh APN 5 77,049,936 (GRCm39) splice site probably null
IGL03398:Aasdh APN 5 77,039,566 (GRCm39) missense probably benign 0.02
1mM(1):Aasdh UTSW 5 77,044,464 (GRCm39) missense possibly damaging 0.91
R0183:Aasdh UTSW 5 77,034,082 (GRCm39) missense probably benign 0.05
R0226:Aasdh UTSW 5 77,049,849 (GRCm39) missense probably damaging 1.00
R0367:Aasdh UTSW 5 77,049,961 (GRCm39) missense probably damaging 0.99
R0386:Aasdh UTSW 5 77,044,308 (GRCm39) missense probably damaging 0.98
R0529:Aasdh UTSW 5 77,024,114 (GRCm39) nonsense probably null
R0881:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R0882:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1033:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1034:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1035:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1036:Aasdh UTSW 5 77,024,130 (GRCm39) missense probably damaging 1.00
R1366:Aasdh UTSW 5 77,036,651 (GRCm39) missense probably benign 0.10
R1446:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1449:Aasdh UTSW 5 77,034,136 (GRCm39) missense probably benign 0.45
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1469:Aasdh UTSW 5 77,039,526 (GRCm39) missense probably damaging 0.97
R1583:Aasdh UTSW 5 77,030,528 (GRCm39) missense probably benign 0.00
R1641:Aasdh UTSW 5 77,039,626 (GRCm39) missense probably benign 0.36
R1876:Aasdh UTSW 5 77,025,396 (GRCm39) missense probably damaging 1.00
R1895:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R1946:Aasdh UTSW 5 77,039,551 (GRCm39) missense probably damaging 1.00
R3615:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3616:Aasdh UTSW 5 77,036,629 (GRCm39) missense probably benign 0.20
R3746:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3747:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3748:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R3750:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R4857:Aasdh UTSW 5 77,035,131 (GRCm39) missense probably benign 0.01
R4928:Aasdh UTSW 5 77,044,535 (GRCm39) missense possibly damaging 0.65
R4937:Aasdh UTSW 5 77,036,501 (GRCm39) nonsense probably null
R5762:Aasdh UTSW 5 77,044,445 (GRCm39) missense probably benign 0.00
R5866:Aasdh UTSW 5 77,024,058 (GRCm39) missense probably damaging 1.00
R5940:Aasdh UTSW 5 77,030,745 (GRCm39) missense probably benign 0.07
R6253:Aasdh UTSW 5 77,034,105 (GRCm39) missense possibly damaging 0.81
R6542:Aasdh UTSW 5 77,030,902 (GRCm39) missense probably damaging 1.00
R6825:Aasdh UTSW 5 77,036,696 (GRCm39) splice site probably null
R6868:Aasdh UTSW 5 77,039,527 (GRCm39) missense probably damaging 0.99
R6876:Aasdh UTSW 5 77,044,288 (GRCm39) missense probably damaging 1.00
R6961:Aasdh UTSW 5 77,024,148 (GRCm39) missense probably damaging 1.00
R6963:Aasdh UTSW 5 77,044,303 (GRCm39) missense probably damaging 0.99
R7069:Aasdh UTSW 5 77,024,203 (GRCm39) missense probably benign 0.03
R7220:Aasdh UTSW 5 77,049,772 (GRCm39) missense probably benign 0.13
R7545:Aasdh UTSW 5 77,027,861 (GRCm39) missense probably damaging 1.00
R7673:Aasdh UTSW 5 77,030,555 (GRCm39) missense probably benign 0.03
R7703:Aasdh UTSW 5 77,035,924 (GRCm39) missense probably damaging 0.99
R7890:Aasdh UTSW 5 77,031,969 (GRCm39) missense probably benign 0.19
R7978:Aasdh UTSW 5 77,036,515 (GRCm39) missense probably damaging 0.99
R8046:Aasdh UTSW 5 77,044,325 (GRCm39) missense probably benign
R8152:Aasdh UTSW 5 77,044,305 (GRCm39) missense probably damaging 1.00
R8425:Aasdh UTSW 5 77,034,124 (GRCm39) missense possibly damaging 0.49
R8884:Aasdh UTSW 5 77,039,641 (GRCm39) missense possibly damaging 0.94
R9028:Aasdh UTSW 5 77,023,977 (GRCm39) missense probably damaging 1.00
R9361:Aasdh UTSW 5 77,030,225 (GRCm39) missense probably benign 0.01
R9519:Aasdh UTSW 5 77,030,572 (GRCm39) missense probably benign 0.00
Z1088:Aasdh UTSW 5 77,049,004 (GRCm39) splice site probably null
Z1176:Aasdh UTSW 5 77,039,643 (GRCm39) critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AATCTGGCATCCACACACTGTC -3'
(R):5'- TCAATGCTAGCACCAGGAGG -3'

Sequencing Primer
(F):5'- ATCAGTGTAACTCCAGTTCCAGGG -3'
(R):5'- GAGCGACACATGGAGTTGC -3'
Posted On 2015-04-06