Incidental Mutation 'R3919:Nr2e3'
ID 306901
Institutional Source Beutler Lab
Gene Symbol Nr2e3
Ensembl Gene ENSMUSG00000032292
Gene Name nuclear receptor subfamily 2, group E, member 3
Synonyms RNR, photoreceptor-specific nuclear receptor, Pnr
MMRRC Submission 040817-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R3919 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 59942771-59960659 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 59943440 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 379 (T379S)
Ref Sequence ENSEMBL: ENSMUSP00000034831 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034831]
AlphaFold Q9QXZ7
Predicted Effect probably damaging
Transcript: ENSMUST00000034831
AA Change: T379S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000034831
Gene: ENSMUSG00000032292
AA Change: T379S

DomainStartEndE-ValueType
ZnF_C4 37 109 1.26e-32 SMART
HOLI 209 367 3.92e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128060
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128108
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144391
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156845
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215963
Meta Mutation Damage Score 0.5186 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This protein is part of a large family of nuclear receptor transcription factors involved in signaling pathways. Nuclear receptors have been shown to regulate pathways involved in embryonic development, as well as in maintenance of proper cell function in adults. Members of this family are characterized by discrete domains that function in DNA and ligand binding. This gene encodes a retinal nuclear receptor that is a ligand-dependent transcription factor. Defects in this gene are a cause of enhanced S cone syndrome. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation exhibit rossettes and a reduced number of nuclei in the retinal outer nuclear layer. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700028J19Rik G T 7: 44,230,428 probably benign Het
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
Abcb5 A G 12: 118,890,618 M854T possibly damaging Het
Akap9 T A 5: 3,961,764 Y822* probably null Het
Apoe T C 7: 19,696,547 T257A probably benign Het
Atm C A 9: 53,492,278 A1365S probably benign Het
Bmp2k T C 5: 97,074,740 S674P unknown Het
Cd177 T C 7: 24,744,433 S747G probably benign Het
Cdk5rap2 A G 4: 70,380,223 F91L possibly damaging Het
Chil4 A T 3: 106,202,532 N388K probably benign Het
Dnah3 G A 7: 119,951,080 L3328F probably damaging Het
Dysf G A 6: 84,186,509 probably null Het
Ercc5 C A 1: 44,161,931 T217K probably damaging Het
Esyt1 T A 10: 128,521,036 probably benign Het
Ifih1 C A 2: 62,623,501 probably benign Het
Ints12 A T 3: 133,100,683 T124S probably benign Het
Kdm5d T C Y: 939,914 L1022P probably damaging Het
Lama2 T A 10: 27,118,505 N1803Y probably damaging Het
Lpcat2 C T 8: 92,914,274 T449I probably damaging Het
Ly6c2 A T 15: 75,108,764 probably null Het
Mast3 T C 8: 70,779,422 K1304E probably benign Het
Mdm4 T C 1: 132,994,568 K279E possibly damaging Het
Mest G A 6: 30,742,750 S132N probably benign Het
Mras T A 9: 99,411,420 I56F probably damaging Het
Mrgprb1 T C 7: 48,448,081 K28E probably benign Het
Myrip G A 9: 120,432,629 G436D probably damaging Het
Olfr1065 A G 2: 86,445,418 V188A probably benign Het
Plscr3 T A 11: 69,847,410 probably benign Het
Pola1 C A X: 93,461,472 R1313L probably benign Het
Ppt2 T C 17: 34,622,923 N213S probably damaging Het
Prelid2 T A 18: 41,937,675 D31V possibly damaging Het
Psmb9 C T 17: 34,183,614 probably null Het
Rec8 A G 14: 55,621,259 T164A probably benign Het
Rnf103 G A 6: 71,510,347 R654Q probably benign Het
Setdb2 T A 14: 59,419,167 I250F probably damaging Het
Slurp1 A T 15: 74,726,810 *111K probably null Het
Sphkap T G 1: 83,276,458 E903A probably damaging Het
Sst T C 16: 23,889,841 D80G possibly damaging Het
Stat4 C T 1: 52,096,822 T430I possibly damaging Het
Tmprss4 C T 9: 45,180,666 V174M probably benign Het
Trim6 A T 7: 104,232,850 Y436F probably damaging Het
Ttc28 C A 5: 111,285,379 A2093E possibly damaging Het
Vav3 A G 3: 109,527,538 N462D possibly damaging Het
Whrn G T 4: 63,495,184 S17* probably null Het
Zfhx4 T A 3: 5,399,115 S1469R possibly damaging Het
Zfp108 T A 7: 24,260,832 C283S probably damaging Het
Other mutations in Nr2e3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02045:Nr2e3 APN 9 59949008 missense probably benign 0.14
R1448:Nr2e3 UTSW 9 59943514 missense probably damaging 1.00
R1521:Nr2e3 UTSW 9 59949205 missense probably damaging 0.99
R1657:Nr2e3 UTSW 9 59948767 missense probably benign 0.08
R1819:Nr2e3 UTSW 9 59943437 missense probably damaging 1.00
R1953:Nr2e3 UTSW 9 59949796 missense probably benign 0.23
R3925:Nr2e3 UTSW 9 59948433 missense probably damaging 1.00
R4654:Nr2e3 UTSW 9 59949072 intron probably benign
R5239:Nr2e3 UTSW 9 59949776 splice site probably benign
R5310:Nr2e3 UTSW 9 59949334 intron probably benign
R5586:Nr2e3 UTSW 9 59949201 missense probably damaging 0.99
R5811:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5812:Nr2e3 UTSW 9 59943418 small deletion probably benign
R5813:Nr2e3 UTSW 9 59943418 small deletion probably benign
R7267:Nr2e3 UTSW 9 59948689 missense possibly damaging 0.68
R7467:Nr2e3 UTSW 9 59949151 splice site probably null
R7642:Nr2e3 UTSW 9 59947388 missense possibly damaging 0.78
R7999:Nr2e3 UTSW 9 59948999 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCATTCTACTGCCCAAGC -3'
(R):5'- CCTGTATTGAAATGCCCCTGG -3'

Sequencing Primer
(F):5'- ATTAGGATGGCAATGAATATGCC -3'
(R):5'- TGGCTGGCCCTGGACAAC -3'
Posted On 2015-04-17