Mutagenetix > Incidental Mutation

Incidental Mutation 'R1457:Zbtb40'

158556

Institutional Source

Beutler Lab

Gene Symbol

Zbtb40

Ensembl Gene

ENSMUSG00000060862

Gene Name

zinc finger and BTB domain containing 40

Synonyms

MMRRC Submission

039512-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.125) question?

Stock #

R1457 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

136979732-137048801 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 136984837 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Serine at position 1187 (A1187S)

Ref Sequence

ENSEMBL: ENSMUSP00000061899 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049583]

AlphaFold

Q6PCS8

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049583
AA Change: A1187S

PolyPhen 2 Score 0.805 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000061899
Gene: ENSMUSG00000060862
AA Change: A1187S

Domain	Start	End	E-Value	Type
low complexity region	8	14	N/A	INTRINSIC
BTB	24	117	3.39e-18	SMART
low complexity region	150	170	N/A	INTRINSIC
low complexity region	525	533	N/A	INTRINSIC
low complexity region	725	741	N/A	INTRINSIC
ZnF_C2H2	754	774	4.86e1	SMART
low complexity region	786	801	N/A	INTRINSIC
ZnF_C2H2	825	848	1.16e-1	SMART
ZnF_C2H2	854	876	1.1e-2	SMART
ZnF_C2H2	882	905	1.16e-1	SMART
ZnF_C2H2	911	933	1.2e-3	SMART
ZnF_C2H2	939	962	8.81e-2	SMART
ZnF_C2H2	969	992	7.05e-1	SMART
ZnF_C2H2	997	1019	1.47e-3	SMART
ZnF_C2H2	1025	1047	2.86e-1	SMART
ZnF_C2H2	1065	1088	6.67e-2	SMART
ZnF_C2H2	1094	1117	6.23e-2	SMART
ZnF_C2H2	1123	1146	1.53e-1	SMART
ZnF_C2H2	1154	1177	1.56e-2	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000218160

Coding Region Coverage

1x: 98.9%
3x: 97.8%
10x: 94.7%
20x: 87.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010300C02Rik	A	T	1: 37,626,012	Y268*	probably null	Het
Abca14	A	T	7: 120,289,460	I1210F	probably benign	Het
Ankrd17	T	C	5: 90,285,846	H688R	possibly damaging	Het
Arhgap24	T	A	5: 102,664,106	N66K	probably damaging	Het
Atp1a1	C	T	3: 101,590,466	G335D	probably damaging	Het
Cacna1g	C	T	11: 94,459,555	R488H	possibly damaging	Het
Cacna1h	A	T	17: 25,397,620	V149E	probably damaging	Het
Cd22	G	T	7: 30,873,170	P338Q	probably benign	Het
Cntln	G	T	4: 85,096,839	M1122I	probably benign	Het
Cntrl	A	G	2: 35,122,756	N302S	probably benign	Het
Cog8	T	C	8: 107,052,896	R250G	probably damaging	Het
Creld2	T	C	15: 88,823,753	C232R	probably damaging	Het
Cyp2b23	G	A	7: 26,673,149	P347L	probably damaging	Het
Dnah5	T	C	15: 28,403,542		probably null	Het
Eml6	C	T	11: 30,024,459	V40I	probably damaging	Het
Epb42	C	T	2: 121,029,967		probably null	Het
Fcrla	A	G	1: 170,921,004	L190P	probably damaging	Het
Galnt18	A	T	7: 111,779,428	Y40*	probably null	Het
Gdf7	A	T	12: 8,298,073	M416K	probably damaging	Het
Gm11232	T	A	4: 71,756,919		probably null	Het
Gpam	T	A	19: 55,088,176	N198Y	probably damaging	Het
Grip1	C	T	10: 119,986,350	S327F	possibly damaging	Het
Hey2	C	T	10: 30,834,356	A134T	probably benign	Het
Kat6a	T	C	8: 22,938,652	I1341T	probably benign	Het
Kcnd3	T	C	3: 105,668,186	L542P	probably benign	Het
Lars	G	A	18: 42,210,050	R1101C	probably damaging	Het
Lman2	T	C	13: 55,351,251	D234G	probably benign	Het
Map3k19	A	C	1: 127,817,898	I1273R	probably damaging	Het
Matn1	T	A	4: 130,950,019	F180I	possibly damaging	Het
Meikin	T	A	11: 54,370,941	L61*	probably null	Het
Mroh2b	G	T	15: 4,925,684	D720Y	probably damaging	Het
Myh13	T	C	11: 67,331,046	I199T	probably damaging	Het
Myh4	T	A	11: 67,248,461	S535T	probably damaging	Het
Myo5a	T	C	9: 75,213,065	M1715T	probably damaging	Het
Nat8	A	T	6: 85,830,989	V54D	probably damaging	Het
Nbea	A	G	3: 56,085,327	V286A	probably damaging	Het
Ndnf	A	G	6: 65,704,014	K426E	possibly damaging	Het
Nup210l	T	A	3: 90,190,972	N1410K	possibly damaging	Het
Oca2	A	T	7: 56,321,521	T399S	probably damaging	Het
Olfr1045	A	G	2: 86,198,252	S167P	probably damaging	Het
Olfr118	A	T	17: 37,672,925	K301*	probably null	Het
Olfr250	G	A	9: 38,368,196	V217I	probably benign	Het
Olfr366	A	C	2: 37,219,659	T57P	possibly damaging	Het
Olfr644	A	T	7: 104,068,459	C191S	probably damaging	Het
Olfr652	T	A	7: 104,565,071	N283K	probably damaging	Het
Otogl	A	C	10: 107,878,152		probably null	Het
Pde4b	C	T	4: 102,605,176	T511I	probably damaging	Het
Proser3	A	G	7: 30,539,747		probably null	Het
Psmd12	G	A	11: 107,479,646	V24M	probably damaging	Het
Rbm17	A	T	2: 11,593,461	M170K	probably benign	Het
Rims2	C	T	15: 39,511,314	T1064I	possibly damaging	Het
Ripor3	C	T	2: 167,992,653	V281M	probably damaging	Het
Rreb1	C	A	13: 37,946,928	Q1353K	possibly damaging	Het
Sgo2a	A	G	1: 58,015,806	D383G	probably benign	Het
Sik3	C	T	9: 46,221,148	T1346M	probably damaging	Het
Slx1b	A	T	7: 126,692,796	V63E	probably damaging	Het
Son	A	G	16: 91,657,086	D907G	probably damaging	Het
Src	G	A	2: 157,469,212	V401M	probably damaging	Het
St3gal4	T	C	9: 35,054,757	K24E	possibly damaging	Het
Stat6	A	G	10: 127,658,245	K647R	probably damaging	Het
Tbl1xr1	G	A	3: 22,193,169		probably null	Het
Tlk2	G	A	11: 105,256,952		probably null	Het
Tmbim6	T	A	15: 99,401,615	I3K	probably benign	Het
Tmeff2	A	T	1: 51,181,867	I334F	probably damaging	Het
Ttn	T	C	2: 76,840,315		probably null	Het
Ubl7	T	A	9: 57,914,611	I81N	probably damaging	Het
Ugt1a10	A	G	1: 88,055,711	Y77C	probably damaging	Het
Uqcrfs1	A	G	13: 30,540,907	C217R	probably damaging	Het
Usp50	T	C	2: 126,761,634	T331A	probably benign	Het
Vmn1r65	A	G	7: 6,009,157	V26A	probably benign	Het
Wdfy3	A	C	5: 101,917,579	V1241G	possibly damaging	Het
Wtap	A	C	17: 12,981,744		probably null	Het
Zfp57	T	C	17: 37,006,098	S20P	probably damaging	Het
Zfp592	A	G	7: 81,024,479	D397G	probably damaging	Het
Zfp747	A	T	7: 127,374,504	S165T	probably benign	Het
Zfp949	C	T	9: 88,569,838	T487I	probably damaging	Het
Zscan4d	A	G	7: 11,164,994	C119R	probably damaging	Het

Other mutations in Zbtb40

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Zbtb40	APN	4	136987340	missense	probably damaging	0.99
IGL00573:Zbtb40	APN	4	137018078	missense	probably benign	0.00
IGL00774:Zbtb40	APN	4	136994524	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0046:Zbtb40	UTSW	4	136987278	missense	probably damaging	1.00
R0334:Zbtb40	UTSW	4	136986556	missense	probably damaging	1.00
R0393:Zbtb40	UTSW	4	137018531	missense	probably benign	0.09
R0482:Zbtb40	UTSW	4	136983228	missense	probably damaging	1.00
R1846:Zbtb40	UTSW	4	137007839	missense	probably benign	0.00
R2153:Zbtb40	UTSW	4	136991635	missense	probably damaging	1.00
R2206:Zbtb40	UTSW	4	137017285	nonsense	probably null
R2291:Zbtb40	UTSW	4	136985017	missense	possibly damaging	0.78
R2406:Zbtb40	UTSW	4	136998568	missense	probably benign	0.34
R3707:Zbtb40	UTSW	4	136999568	missense	probably damaging	1.00
R4131:Zbtb40	UTSW	4	136995396	missense	probably benign	0.00
R4243:Zbtb40	UTSW	4	137018549	missense	probably benign	0.00
R4424:Zbtb40	UTSW	4	136998694	missense	probably damaging	0.96
R4725:Zbtb40	UTSW	4	137018761	utr 5 prime	probably benign
R4784:Zbtb40	UTSW	4	137007097	missense	probably damaging	1.00
R4795:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4796:Zbtb40	UTSW	4	136998642	missense	probably benign	0.00
R4838:Zbtb40	UTSW	4	137001216	missense	probably benign	0.15
R4859:Zbtb40	UTSW	4	136988759	missense	probably damaging	0.98
R4883:Zbtb40	UTSW	4	137000930	missense	probably benign	0.09
R5001:Zbtb40	UTSW	4	136996150	missense	probably damaging	1.00
R5030:Zbtb40	UTSW	4	136997952	missense	probably benign	0.00
R5060:Zbtb40	UTSW	4	137001293	missense	possibly damaging	0.71
R5529:Zbtb40	UTSW	4	136983163	missense	possibly damaging	0.90
R5536:Zbtb40	UTSW	4	136987331	missense	probably damaging	1.00
R5589:Zbtb40	UTSW	4	136995283	missense	probably damaging	1.00
R6114:Zbtb40	UTSW	4	136988691	missense	probably damaging	1.00
R6393:Zbtb40	UTSW	4	136984866	missense	probably null
R7208:Zbtb40	UTSW	4	136999626	splice site	probably null
R7406:Zbtb40	UTSW	4	137000894	missense	probably benign	0.29
R7722:Zbtb40	UTSW	4	136991518	missense	probably damaging	0.98
R7803:Zbtb40	UTSW	4	137017327	missense	probably benign
R8292:Zbtb40	UTSW	4	136999567	missense	probably damaging	1.00
R8735:Zbtb40	UTSW	4	136998646	missense	probably damaging	1.00
R8890:Zbtb40	UTSW	4	136998586	missense	probably damaging	1.00
R9003:Zbtb40	UTSW	4	137018593	missense	probably damaging	1.00
R9290:Zbtb40	UTSW	4	137018218	missense	probably benign	0.00
R9328:Zbtb40	UTSW	4	137018309	missense	probably benign	0.00
RF014:Zbtb40	UTSW	4	137017306	missense	probably benign	0.20
Z1176:Zbtb40	UTSW	4	136995463	missense	probably damaging	1.00
Z1177:Zbtb40	UTSW	4	137018024	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- GGTGTTCCACTTTGGCAAATTCCC -3'
(R):5'- AAGCCACTAGCCGCTCTGTATCTG -3'

Sequencing Primer
(F):5'- GGCCACTGACAGACTAGAGTTTC -3'
(R):5'- ACAGCCGAATGATGTCTCTG -3'

Posted On

2014-03-14