Incidental Mutation 'R4154:Pik3c3'
ID315064
Institutional Source Beutler Lab
Gene Symbol Pik3c3
Ensembl Gene ENSMUSG00000033628
Gene Namephosphatidylinositol 3-kinase catalytic subunit type 3
Synonyms5330434F23Rik, Vps34
MMRRC Submission 040998-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4154 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location30272747-30348126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 30311283 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 516 (M516I)
Ref Sequence ENSEMBL: ENSMUSP00000111478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091978] [ENSMUST00000115811] [ENSMUST00000115812] [ENSMUST00000131405]
Predicted Effect probably benign
Transcript: ENSMUST00000091978
AA Change: M516I

PolyPhen 2 Score 0.082 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000089601
Gene: ENSMUSG00000033628
AA Change: M516I

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 848 1.02e-84 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115811
AA Change: M516I

PolyPhen 2 Score 0.348 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000111478
Gene: ENSMUSG00000033628
AA Change: M516I

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 756 5.33e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115812
AA Change: M516I

PolyPhen 2 Score 0.189 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000111479
Gene: ENSMUSG00000033628
AA Change: M516I

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 530 3.08e-111 SMART
PI3Kc 632 884 1.21e-118 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131405
SMART Domains Protein: ENSMUSP00000128927
Gene: ENSMUSG00000033628

DomainStartEndE-ValueType
C2 20 141 4.44e0 SMART
PI3K_C2 21 130 1.43e-42 SMART
PI3Ka 283 506 1.78e-84 SMART
Meta Mutation Damage Score 0.0952 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.5%
Validation Efficiency 98% (51/52)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display embryonic lethality between implantation and placentation, arrest prior to gastrulation, and show reduced cell proliferation. Mice homozygous for a conditional allele activated in T cells exhibit impaired naive Tcell homeostasis and mitophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI593442 A T 9: 52,677,904 H124Q probably benign Het
Asph C T 4: 9,639,250 W38* probably null Het
Bicdl2 A G 17: 23,666,092 probably null Het
Chd8 T C 14: 52,207,211 probably benign Het
Clcn4 T C 7: 7,294,834 N67D probably benign Het
Cptp A G 4: 155,867,200 V12A possibly damaging Het
Crim1 A G 17: 78,237,843 I145V probably benign Het
Ctsc G A 7: 88,299,547 M195I probably benign Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Fas T G 19: 34,318,828 I180S possibly damaging Het
Fsip2 A C 2: 82,987,069 E4382A possibly damaging Het
Galnt5 T G 2: 57,998,493 L35R probably damaging Het
Gfpt2 G A 11: 49,835,778 probably null Het
Gjd4 G T 18: 9,280,811 S89* probably null Het
Gm14496 A T 2: 181,995,079 H110L probably benign Het
Golm1 A G 13: 59,642,353 V211A probably benign Het
Gsc2 TGCAGCAGCAGCAGCAG TGCAGCAGCAGCAG 16: 17,914,802 probably benign Het
Ighv1-72 A T 12: 115,758,397 M7K probably benign Het
Igkv12-44 C T 6: 69,814,655 C108Y possibly damaging Het
Lum T C 10: 97,568,953 S237P probably damaging Het
Macf1 T C 4: 123,471,813 K3052E probably damaging Het
Mdn1 A G 4: 32,707,475 E1588G probably damaging Het
Ndst3 T C 3: 123,672,227 Y32C probably damaging Het
Nucb2 A G 7: 116,527,667 T172A probably benign Het
Olfr690 T C 7: 105,329,385 N269S probably damaging Het
Pard3 G T 8: 127,474,396 R978L probably damaging Het
Pcdha4 A G 18: 36,953,586 probably null Het
Pgk2 A G 17: 40,208,258 V93A probably damaging Het
Plxnb2 A G 15: 89,159,642 F1336L probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Sipa1l1 G C 12: 82,425,214 G1323R possibly damaging Het
Sntg1 A T 1: 8,583,345 probably null Het
Spef2 T C 15: 9,626,021 K1153R probably benign Het
Strn3 C T 12: 51,627,131 V566M probably damaging Het
Svep1 A G 4: 58,069,068 F2906S possibly damaging Het
Tbc1d8 C T 1: 39,386,135 V545M probably damaging Het
Tmem131 T C 1: 36,808,793 probably benign Het
Tnfsf8 A G 4: 63,834,358 S157P probably benign Het
Tubgcp5 G A 7: 55,805,329 V258M probably benign Het
Vat1l G C 8: 114,205,803 G30R possibly damaging Het
Vegfb T C 19: 6,986,078 Y106C probably damaging Het
Vmn2r100 AAAACAGGAGTATTGATTGGAAAC AAAAC 17: 19,523,419 probably null Het
Zc3h15 T C 2: 83,658,569 V161A probably benign Het
Other mutations in Pik3c3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Pik3c3 APN 18 30303078 splice site probably benign
IGL00743:Pik3c3 APN 18 30274364 missense probably damaging 1.00
IGL01622:Pik3c3 APN 18 30290525 nonsense probably null
IGL01622:Pik3c3 APN 18 30293049 splice site probably benign
IGL01623:Pik3c3 APN 18 30290525 nonsense probably null
IGL01623:Pik3c3 APN 18 30293049 splice site probably benign
IGL01773:Pik3c3 APN 18 30277102 missense probably damaging 1.00
IGL01917:Pik3c3 APN 18 30274446 missense probably damaging 1.00
IGL02033:Pik3c3 APN 18 30312650 missense possibly damaging 0.85
IGL02465:Pik3c3 APN 18 30344060 missense probably damaging 0.97
IGL03161:Pik3c3 APN 18 30293707 missense probably benign 0.37
IGL03221:Pik3c3 APN 18 30302931 missense probably benign 0.45
H8786:Pik3c3 UTSW 18 30294343 missense probably damaging 0.99
R0089:Pik3c3 UTSW 18 30303078 splice site probably benign
R1512:Pik3c3 UTSW 18 30322236 critical splice donor site probably null
R1713:Pik3c3 UTSW 18 30323586 missense possibly damaging 0.73
R1758:Pik3c3 UTSW 18 30277010 missense probably damaging 1.00
R1822:Pik3c3 UTSW 18 30344077 critical splice donor site probably null
R1870:Pik3c3 UTSW 18 30293132 critical splice donor site probably null
R2680:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R3768:Pik3c3 UTSW 18 30333273 missense probably damaging 1.00
R3926:Pik3c3 UTSW 18 30311329 splice site probably benign
R4293:Pik3c3 UTSW 18 30343990 missense probably damaging 1.00
R4570:Pik3c3 UTSW 18 30290550 missense possibly damaging 0.94
R4858:Pik3c3 UTSW 18 30344078 critical splice donor site probably null
R4893:Pik3c3 UTSW 18 30282000 missense probably benign 0.16
R4901:Pik3c3 UTSW 18 30302929 missense possibly damaging 0.65
R5216:Pik3c3 UTSW 18 30272976 missense probably damaging 1.00
R5358:Pik3c3 UTSW 18 30323544 missense probably damaging 1.00
R5373:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5374:Pik3c3 UTSW 18 30312561 missense probably benign 0.40
R5600:Pik3c3 UTSW 18 30311293 missense probably damaging 1.00
R5680:Pik3c3 UTSW 18 30277113 nonsense probably null
R5965:Pik3c3 UTSW 18 30298580 missense probably damaging 1.00
R6492:Pik3c3 UTSW 18 30324562 missense probably damaging 1.00
R6576:Pik3c3 UTSW 18 30342741 intron probably benign
R6700:Pik3c3 UTSW 18 30316901 missense probably benign 0.02
R7523:Pik3c3 UTSW 18 30293655 missense probably damaging 1.00
R7883:Pik3c3 UTSW 18 30274363 missense probably benign 0.04
R7884:Pik3c3 UTSW 18 30312571 missense probably benign 0.00
R7886:Pik3c3 UTSW 18 30319588 nonsense probably null
R8075:Pik3c3 UTSW 18 30305029 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCGCTGGAAGGTGTCTTTAC -3'
(R):5'- GTTGTAGTGATTCACCCATGGG -3'

Sequencing Primer
(F):5'- GCTGGAAGGTGTCTTTACTCCTC -3'
(R):5'- CATGTCAGTGCACGATTGAGC -3'
Posted On2015-05-14