Incidental Mutation 'R4064:Olfr1141'
ID315999
Institutional Source Beutler Lab
Gene Symbol Olfr1141
Ensembl Gene ENSMUSG00000075148
Gene Nameolfactory receptor 1141
SynonymsMOR177-10, GA_x6K02T2Q125-49257818-49256883
MMRRC Submission 041620-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R4064 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location87753056-87753991 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87753789 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 68 (F68S)
Ref Sequence ENSEMBL: ENSMUSP00000097433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099846]
Predicted Effect probably damaging
Transcript: ENSMUST00000099846
AA Change: F68S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097433
Gene: ENSMUSG00000075148
AA Change: F68S

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.8e-28 PFAM
Pfam:7tm_1 41 290 1.5e-6 PFAM
Meta Mutation Damage Score 0.4160 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (44/44)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc2 T G 19: 43,804,993 Y361* probably null Het
Afmid A G 11: 117,836,528 T293A probably benign Het
Ago4 A T 4: 126,515,862 probably benign Het
Alkbh2 C T 5: 114,124,226 E148K probably damaging Het
Axl C A 7: 25,764,020 V602L probably benign Het
Cdc5l C T 17: 45,410,890 A485T probably benign Het
Duoxa2 G T 2: 122,300,577 S73I probably damaging Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Etfdh T C 3: 79,605,791 E435G possibly damaging Het
Fbxo15 C T 18: 84,959,118 R52C probably damaging Het
Fosb G T 7: 19,305,192 C186* probably null Het
Gtpbp2 G A 17: 46,167,327 R467H probably damaging Het
Hnrnpll T C 17: 80,032,772 H526R probably benign Het
Mphosph9 A T 5: 124,290,917 F683I probably damaging Het
Mrps24 G A 11: 5,704,676 R93* probably null Het
Nhlh2 A G 3: 102,012,736 D28G probably benign Het
Olfr1 A T 11: 73,395,522 S167T probably benign Het
Otogl A T 10: 107,790,649 D1451E probably benign Het
Otop2 G A 11: 115,329,375 G347D probably damaging Het
Parp4 A G 14: 56,624,140 S977G probably benign Het
Psmb7 T C 2: 38,640,176 T98A probably damaging Het
Pus10 A G 11: 23,728,983 K485R probably damaging Het
Rab11fip3 T C 17: 26,024,394 D588G probably damaging Het
Rgl2 T A 17: 33,937,108 D723E possibly damaging Het
Rp1 A T 1: 4,345,400 S1830T probably benign Het
Rreb1 T C 13: 37,930,317 S551P probably benign Het
Serpinb7 A T 1: 107,446,036 E127D probably benign Het
Sh3pxd2b G T 11: 32,422,263 A477S probably benign Het
Slc26a9 T C 1: 131,763,187 Y568H probably benign Het
Tarsl2 G A 7: 65,652,270 A181T possibly damaging Het
Tbc1d2b T A 9: 90,218,922 K672* probably null Het
Tmem59l T C 8: 70,485,719 T168A probably damaging Het
Tshz2 A G 2: 169,962,325 probably benign Het
Vmn1r9 T C 6: 57,071,321 F127S probably damaging Het
Zfp282 G A 6: 47,880,094 R87H probably damaging Het
Zfp292 A G 4: 34,810,863 V727A probably damaging Het
Zscan22 C T 7: 12,907,014 T395I probably damaging Het
Other mutations in Olfr1141
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01143:Olfr1141 APN 2 87753934 missense probably benign 0.00
IGL01412:Olfr1141 APN 2 87753117 missense probably damaging 1.00
IGL01533:Olfr1141 APN 2 87753068 missense probably benign 0.01
IGL02455:Olfr1141 APN 2 87753583 missense possibly damaging 0.95
IGL02698:Olfr1141 APN 2 87753844 nonsense probably null
PIT4480001:Olfr1141 UTSW 2 87753783 missense possibly damaging 0.95
R0543:Olfr1141 UTSW 2 87753650 missense probably damaging 1.00
R1542:Olfr1141 UTSW 2 87753318 missense probably damaging 0.99
R1750:Olfr1141 UTSW 2 87753186 missense probably damaging 0.97
R1844:Olfr1141 UTSW 2 87753990 start codon destroyed probably null 1.00
R2248:Olfr1141 UTSW 2 87753943 missense probably null 0.05
R5193:Olfr1141 UTSW 2 87753104 missense possibly damaging 0.59
R5861:Olfr1141 UTSW 2 87753578 missense probably benign 0.01
R6146:Olfr1141 UTSW 2 87753258 missense probably damaging 1.00
R6197:Olfr1141 UTSW 2 87753352 missense probably benign 0.15
R6481:Olfr1141 UTSW 2 87753468 missense probably damaging 1.00
R6857:Olfr1141 UTSW 2 87753487 missense probably damaging 1.00
R6904:Olfr1141 UTSW 2 87753879 missense probably benign 0.00
R6962:Olfr1141 UTSW 2 87753727 missense probably benign
R7014:Olfr1141 UTSW 2 87753871 missense probably benign 0.00
R8229:Olfr1141 UTSW 2 87753064 missense probably benign 0.00
T0722:Olfr1141 UTSW 2 87753123 missense probably damaging 1.00
Z1177:Olfr1141 UTSW 2 87753190 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- ATGGCATATATCACGGGGTG -3'
(R):5'- CATGGACAAGGAAAACTGTTCTTC -3'

Sequencing Primer
(F):5'- CATATATCACGGGGTGGCTTATG -3'
(R):5'- GGACAAGGAAAACTGTTCTTCATTAC -3'
Posted On2015-05-15