Incidental Mutation 'R4208:Abcc6'
ID319028
Institutional Source Beutler Lab
Gene Symbol Abcc6
Ensembl Gene ENSMUSG00000030834
Gene NameATP-binding cassette, sub-family C (CFTR/MRP), member 6
SynonymsMrp6, DCC, Dyscalc1
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.800) question?
Stock #R4208 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location45967555-46030302 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 45986563 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Arginine at position 1020 (L1020R)
Ref Sequence ENSEMBL: ENSMUSP00000002850 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002850]
Predicted Effect probably damaging
Transcript: ENSMUST00000002850
AA Change: L1020R

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000002850
Gene: ENSMUSG00000030834
AA Change: L1020R

DomainStartEndE-ValueType
transmembrane domain 44 61 N/A INTRINSIC
transmembrane domain 81 100 N/A INTRINSIC
transmembrane domain 110 129 N/A INTRINSIC
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 171 193 N/A INTRINSIC
Pfam:ABC_membrane 309 580 3.5e-29 PFAM
AAA 653 828 1.19e-9 SMART
low complexity region 871 885 N/A INTRINSIC
Pfam:ABC_membrane 942 1211 2.5e-32 PFAM
AAA 1286 1473 1.71e-10 SMART
Meta Mutation Damage Score 0.9464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MRP subfamily which is involved in multi-drug resistance. The specific function of this protein is unknown; however, a similar rat protein has been identified as the major canalicular bile salt export pump of liver. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display patchy mineralization which may include the capsule surrounding the sinuses of vibrissae, medium sized arteries, skin, retina, kidney, and interscapular brown fat. Strain differences at this locus may lead to altered susceptibility to cardiac calcinosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abca8b G A 11: 109,981,725 Q17* probably null Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Cyp2c65 T C 19: 39,090,655 S393P probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr1231 A T 2: 89,302,926 I222N probably damaging Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in Abcc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01589:Abcc6 APN 7 46002672 splice site probably benign
IGL01731:Abcc6 APN 7 46002610 missense possibly damaging 0.71
IGL01743:Abcc6 APN 7 45996814 missense probably benign 0.02
IGL01757:Abcc6 APN 7 45990281 splice site probably benign
IGL01895:Abcc6 APN 7 46029058 missense possibly damaging 0.88
IGL01942:Abcc6 APN 7 45986573 missense possibly damaging 0.89
IGL02251:Abcc6 APN 7 45977416 missense probably damaging 1.00
IGL02277:Abcc6 APN 7 46001061 missense probably benign 0.00
IGL02548:Abcc6 APN 7 46005262 missense probably damaging 0.98
IGL03063:Abcc6 APN 7 46016432 missense probably benign
IGL03092:Abcc6 APN 7 45986470 missense probably damaging 1.00
IGL03251:Abcc6 APN 7 45982237 unclassified probably benign
R0057:Abcc6 UTSW 7 46020143 missense probably benign 0.03
R0944:Abcc6 UTSW 7 46015505 missense possibly damaging 0.81
R1019:Abcc6 UTSW 7 46014107 missense possibly damaging 0.77
R1183:Abcc6 UTSW 7 45985253 missense probably damaging 0.99
R1543:Abcc6 UTSW 7 46016504 missense probably benign 0.01
R1550:Abcc6 UTSW 7 46005244 missense probably benign 0.25
R1725:Abcc6 UTSW 7 45992357 missense possibly damaging 0.76
R1907:Abcc6 UTSW 7 46014169 missense probably benign 0.04
R1908:Abcc6 UTSW 7 46020134 splice site probably null
R1909:Abcc6 UTSW 7 46020134 splice site probably null
R2138:Abcc6 UTSW 7 45981051 missense probably damaging 1.00
R2145:Abcc6 UTSW 7 45998741 missense probably benign 0.01
R2402:Abcc6 UTSW 7 46015575 missense probably benign 0.04
R3983:Abcc6 UTSW 7 45995289 missense probably benign
R4013:Abcc6 UTSW 7 46018680 missense probably benign 0.01
R4051:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4052:Abcc6 UTSW 7 45986563 missense probably damaging 1.00
R4362:Abcc6 UTSW 7 45998832 splice site probably benign
R4385:Abcc6 UTSW 7 45995328 missense possibly damaging 0.93
R4399:Abcc6 UTSW 7 46002607 missense probably benign
R4479:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4480:Abcc6 UTSW 7 46005239 missense possibly damaging 0.60
R4780:Abcc6 UTSW 7 45996691 missense probably benign
R4791:Abcc6 UTSW 7 45982160 missense probably benign 0.00
R4895:Abcc6 UTSW 7 45980990 missense possibly damaging 0.95
R4898:Abcc6 UTSW 7 45989687 missense probably damaging 0.96
R4905:Abcc6 UTSW 7 45995225 missense probably benign
R4941:Abcc6 UTSW 7 46012523 missense probably benign 0.00
R5040:Abcc6 UTSW 7 46020154 missense probably benign 0.04
R5128:Abcc6 UTSW 7 45989646 missense probably benign 0.00
R5284:Abcc6 UTSW 7 45981059 missense probably benign 0.05
R5328:Abcc6 UTSW 7 45992311 missense probably benign 0.01
R5459:Abcc6 UTSW 7 45982183 missense probably benign 0.00
R5543:Abcc6 UTSW 7 45989536 critical splice donor site probably null
R6178:Abcc6 UTSW 7 46029044 missense probably benign
R6228:Abcc6 UTSW 7 46030256 missense probably benign 0.02
R6532:Abcc6 UTSW 7 45977379 missense probably damaging 1.00
R6605:Abcc6 UTSW 7 45981057 missense probably damaging 1.00
R7000:Abcc6 UTSW 7 46005522 missense possibly damaging 0.60
R7067:Abcc6 UTSW 7 46018690 missense probably benign
R7553:Abcc6 UTSW 7 45999121 missense probably damaging 1.00
R7597:Abcc6 UTSW 7 45995237 missense probably damaging 1.00
R7718:Abcc6 UTSW 7 45977392 missense possibly damaging 0.91
R7781:Abcc6 UTSW 7 46005606 missense probably damaging 1.00
R7798:Abcc6 UTSW 7 45976853 nonsense probably null
X0065:Abcc6 UTSW 7 46020197 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TACCTGAAACCCAGCATAGAGG -3'
(R):5'- TCCGGCAGTGCATCTATCAC -3'

Sequencing Primer
(F):5'- CCCAGCATAGAGGACCATGAG -3'
(R):5'- ATCACATCACGGTCATCTGGGTG -3'
Posted On2015-06-10