Incidental Mutation 'R4208:Abca8b'
ID 319036
Institutional Source Beutler Lab
Gene Symbol Abca8b
Ensembl Gene ENSMUSG00000020620
Gene Name ATP-binding cassette, sub-family A (ABC1), member 8b
Synonyms Abca8
MMRRC Submission 041037-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R4208 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 109932190-109995845 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 109981725 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Stop codon at position 17 (Q17*)
Ref Sequence ENSEMBL: ENSMUSP00000102280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020948] [ENSMUST00000106669]
AlphaFold Q8K440
Predicted Effect probably null
Transcript: ENSMUST00000020948
AA Change: Q17*
SMART Domains Protein: ENSMUSP00000020948
Gene: ENSMUSG00000020620
AA Change: Q17*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 417 3.9e-28 PFAM
AAA 507 691 6.36e-10 SMART
Pfam:ABC2_membrane_3 859 1215 1e-10 PFAM
low complexity region 1246 1255 N/A INTRINSIC
AAA 1313 1492 6.17e-8 SMART
low complexity region 1597 1607 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106669
AA Change: Q17*
SMART Domains Protein: ENSMUSP00000102280
Gene: ENSMUSG00000020620
AA Change: Q17*

DomainStartEndE-ValueType
Pfam:ABC2_membrane_3 28 344 2.6e-16 PFAM
AAA 445 629 6.36e-10 SMART
transmembrane domain 798 815 N/A INTRINSIC
transmembrane domain 1001 1023 N/A INTRINSIC
transmembrane domain 1038 1060 N/A INTRINSIC
transmembrane domain 1072 1091 N/A INTRINSIC
transmembrane domain 1101 1123 N/A INTRINSIC
transmembrane domain 1136 1158 N/A INTRINSIC
low complexity region 1184 1193 N/A INTRINSIC
AAA 1251 1430 6.17e-8 SMART
low complexity region 1535 1545 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 95.1%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. The encoded protein may regulate lipid metabolism and be involved in the formation and maintenance of myelin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,647 D527V probably damaging Het
A1cf T C 19: 31,932,660 L284P probably benign Het
Abcc6 A C 7: 45,986,563 L1020R probably damaging Het
Ace2 A G X: 164,169,585 I110V probably benign Het
Adamts12 A G 15: 11,071,754 H128R probably benign Het
Apol9a G C 15: 77,404,396 T257S probably benign Het
B4galnt3 A G 6: 120,215,102 S557P probably damaging Het
C3 C T 17: 57,205,303 D1542N possibly damaging Het
Casp12 T C 9: 5,346,629 L52P probably damaging Het
Cep126 C T 9: 8,100,821 E571K probably damaging Het
Cfhr1 A G 1: 139,547,878 probably benign Het
Cmah A G 13: 24,417,427 probably null Het
Col10a1 C T 10: 34,395,543 P504S probably damaging Het
Ctnna3 T A 10: 64,959,778 D758E probably benign Het
Cyp2c65 T C 19: 39,090,655 S393P probably damaging Het
Dclk2 A G 3: 86,830,822 probably null Het
Dis3 T G 14: 99,095,316 I227L probably benign Het
Efhc2 T C X: 17,230,550 N186S possibly damaging Het
F13b G T 1: 139,516,341 W471L probably damaging Het
Fam181a A G 12: 103,315,914 D26G probably damaging Het
Gabpb2 A G 3: 95,203,934 probably benign Het
Gm7293 A G 9: 51,623,579 noncoding transcript Het
H3f3a C T 1: 180,803,138 R117H probably benign Het
Ino80b G C 6: 83,122,333 P178R probably damaging Het
Kif3b G A 2: 153,323,557 R628Q probably damaging Het
Lars T C 18: 42,229,703 E557G probably benign Het
Ldlrad3 C T 2: 101,953,162 D240N probably damaging Het
Lingo2 T C 4: 35,709,810 I57V probably benign Het
Lsr A G 7: 30,973,094 I27T probably benign Het
Me2 T C 18: 73,791,085 K352R probably benign Het
Met T C 6: 17,548,729 V924A possibly damaging Het
Mpp3 T C 11: 102,000,600 T571A probably benign Het
Olfr1231 A T 2: 89,302,926 I222N probably damaging Het
Olfr665 A G 7: 104,881,603 T299A probably damaging Het
Padi1 C A 4: 140,817,227 V552L possibly damaging Het
Pfkfb1 A T X: 150,622,188 D208V possibly damaging Het
Rnase4 A G 14: 51,105,005 K62R probably benign Het
RP24-126A19.1 C A 5: 146,895,796 R123L noncoding transcript Het
Scn10a T A 9: 119,616,776 E1438V probably damaging Het
Sfmbt2 T A 2: 10,542,982 D458E probably damaging Het
Slitrk3 T A 3: 73,051,157 Y94F possibly damaging Het
Sstr2 A C 11: 113,624,656 T134P probably damaging Het
Steap4 A G 5: 7,980,404 Y420C probably damaging Het
Tamm41 AGGG AGG 6: 115,012,359 probably benign Het
Trav7-3 A G 14: 53,443,746 T82A probably benign Het
Trbv23 A T 6: 41,216,088 I6F probably benign Het
Vmn1r87 A G 7: 13,132,258 V34A probably benign Het
Zc3h7a C T 16: 11,164,644 E6K possibly damaging Het
Zfp606 G A 7: 12,494,175 C683Y probably damaging Het
Other mutations in Abca8b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00862:Abca8b APN 11 109953548 missense possibly damaging 0.66
IGL00952:Abca8b APN 11 109969060 critical splice donor site probably null
IGL01141:Abca8b APN 11 109937730 missense probably damaging 1.00
IGL01523:Abca8b APN 11 109976494 missense probably damaging 1.00
IGL01633:Abca8b APN 11 109936754 missense probably damaging 0.99
IGL01862:Abca8b APN 11 109947171 nonsense probably null
IGL01963:Abca8b APN 11 109971763 missense probably damaging 0.99
IGL02169:Abca8b APN 11 109952582 missense probably damaging 0.98
IGL02536:Abca8b APN 11 109981748 missense probably benign 0.02
IGL02658:Abca8b APN 11 109952560 missense probably benign
IGL02828:Abca8b APN 11 109980894 missense probably damaging 0.99
IGL03118:Abca8b APN 11 109947181 missense possibly damaging 0.66
IGL03302:Abca8b APN 11 109967750 missense possibly damaging 0.80
IGL03325:Abca8b APN 11 109953596 missense possibly damaging 0.94
R0057:Abca8b UTSW 11 109941559 missense possibly damaging 0.91
R0131:Abca8b UTSW 11 109942289 missense possibly damaging 0.46
R0226:Abca8b UTSW 11 109957018 splice site probably null
R0426:Abca8b UTSW 11 109955027 splice site probably benign
R0432:Abca8b UTSW 11 109980015 missense possibly damaging 0.94
R0512:Abca8b UTSW 11 109950650 missense probably benign 0.32
R0589:Abca8b UTSW 11 109942268 missense probably damaging 0.96
R0690:Abca8b UTSW 11 109969808 splice site probably benign
R1263:Abca8b UTSW 11 109941607 missense possibly damaging 0.66
R1371:Abca8b UTSW 11 109953553 missense probably damaging 0.99
R1497:Abca8b UTSW 11 109973821 splice site probably benign
R1502:Abca8b UTSW 11 109974645 missense probably damaging 1.00
R1517:Abca8b UTSW 11 109971814 missense possibly damaging 0.66
R1543:Abca8b UTSW 11 109974674 missense probably damaging 0.98
R1618:Abca8b UTSW 11 109949888 splice site probably benign
R1625:Abca8b UTSW 11 109967121 missense probably benign 0.11
R1753:Abca8b UTSW 11 109973716 missense probably benign 0.00
R1819:Abca8b UTSW 11 109981056 critical splice acceptor site probably null
R1822:Abca8b UTSW 11 109957075 missense possibly damaging 0.92
R1829:Abca8b UTSW 11 109942341 missense probably damaging 0.97
R1873:Abca8b UTSW 11 109979955 missense probably benign 0.01
R1899:Abca8b UTSW 11 109937918 missense possibly damaging 0.92
R1908:Abca8b UTSW 11 109957098 missense possibly damaging 0.92
R1962:Abca8b UTSW 11 109979898 missense probably benign 0.00
R1984:Abca8b UTSW 11 109977841 missense probably damaging 1.00
R2035:Abca8b UTSW 11 109957106 missense possibly damaging 0.94
R2092:Abca8b UTSW 11 109966708 missense possibly damaging 0.63
R2100:Abca8b UTSW 11 109937782 missense probably damaging 1.00
R2267:Abca8b UTSW 11 109955148 missense probably benign 0.03
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2871:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2872:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R2873:Abca8b UTSW 11 109955176 missense possibly damaging 0.83
R3711:Abca8b UTSW 11 109946255 missense possibly damaging 0.46
R3937:Abca8b UTSW 11 109974567 missense probably benign 0.01
R4052:Abca8b UTSW 11 109981725 nonsense probably null
R4060:Abca8b UTSW 11 109957201 missense probably benign 0.04
R4207:Abca8b UTSW 11 109981725 nonsense probably null
R4354:Abca8b UTSW 11 109971692 missense probably benign 0.27
R4399:Abca8b UTSW 11 109936385 missense possibly damaging 0.66
R4456:Abca8b UTSW 11 109942245 missense probably benign 0.27
R4509:Abca8b UTSW 11 109966755 missense probably damaging 1.00
R4672:Abca8b UTSW 11 109936448 missense possibly damaging 0.81
R4868:Abca8b UTSW 11 109974512 missense probably benign 0.05
R5002:Abca8b UTSW 11 109961797 missense probably damaging 0.96
R5007:Abca8b UTSW 11 109936764 missense probably damaging 1.00
R5014:Abca8b UTSW 11 109950131 missense probably damaging 0.98
R5023:Abca8b UTSW 11 109974988 critical splice donor site probably null
R5091:Abca8b UTSW 11 109936384 missense possibly damaging 0.92
R5098:Abca8b UTSW 11 109957118 missense probably benign 0.05
R5117:Abca8b UTSW 11 109966803 missense probably damaging 1.00
R5234:Abca8b UTSW 11 109976594 missense possibly damaging 0.90
R5302:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5307:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5487:Abca8b UTSW 11 109953514 missense probably damaging 0.99
R5512:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5564:Abca8b UTSW 11 109934581 missense probably benign 0.08
R5610:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5677:Abca8b UTSW 11 109940861 missense probably damaging 1.00
R5723:Abca8b UTSW 11 109953619 missense possibly damaging 0.90
R5827:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5829:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5848:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5849:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5850:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5854:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R5982:Abca8b UTSW 11 109953597 missense possibly damaging 0.80
R5994:Abca8b UTSW 11 109949766 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6035:Abca8b UTSW 11 109971860 splice site probably null
R6050:Abca8b UTSW 11 109977813 missense probably damaging 1.00
R6145:Abca8b UTSW 11 109973808 missense probably benign 0.03
R6223:Abca8b UTSW 11 109977846 missense probably benign 0.00
R6349:Abca8b UTSW 11 109934718 splice site probably null
R7002:Abca8b UTSW 11 109941564 missense probably damaging 1.00
R7050:Abca8b UTSW 11 109973718 missense possibly damaging 0.90
R7107:Abca8b UTSW 11 109976473 missense probably damaging 0.98
R7158:Abca8b UTSW 11 109934589 missense probably damaging 1.00
R7170:Abca8b UTSW 11 109945828 missense probably benign 0.09
R7197:Abca8b UTSW 11 109945822 nonsense probably null
R7220:Abca8b UTSW 11 109981717 missense probably damaging 1.00
R7512:Abca8b UTSW 11 109938449 missense probably benign 0.01
R7590:Abca8b UTSW 11 109938515 missense probably damaging 0.97
R7658:Abca8b UTSW 11 109935717 missense probably benign 0.00
R7739:Abca8b UTSW 11 109974591 missense probably benign 0.05
R7797:Abca8b UTSW 11 109971683 critical splice donor site probably null
R7934:Abca8b UTSW 11 109975039 missense possibly damaging 0.75
R8074:Abca8b UTSW 11 109938494 missense probably benign
R8302:Abca8b UTSW 11 109962580 critical splice donor site probably null
R8341:Abca8b UTSW 11 109955050 missense probably damaging 1.00
R8486:Abca8b UTSW 11 109967111 missense possibly damaging 0.83
R8748:Abca8b UTSW 11 109945771 missense probably damaging 1.00
R8924:Abca8b UTSW 11 109947177 missense probably benign 0.00
R9002:Abca8b UTSW 11 109952630 missense probably benign 0.02
R9032:Abca8b UTSW 11 109957247 missense probably benign 0.04
R9099:Abca8b UTSW 11 109980882 missense probably damaging 1.00
R9124:Abca8b UTSW 11 109937767 missense probably damaging 0.97
R9178:Abca8b UTSW 11 109950111 missense probably benign 0.00
R9188:Abca8b UTSW 11 109981735 nonsense probably null
R9277:Abca8b UTSW 11 109976521 missense probably damaging 0.99
R9340:Abca8b UTSW 11 109950113 missense probably benign 0.43
R9371:Abca8b UTSW 11 109967672 missense probably damaging 1.00
R9382:Abca8b UTSW 11 109979885 missense probably benign
R9450:Abca8b UTSW 11 109969104 missense probably damaging 0.98
R9462:Abca8b UTSW 11 109953607 missense
R9712:Abca8b UTSW 11 109942337 missense probably benign 0.30
Z1088:Abca8b UTSW 11 109976482 missense probably benign 0.09
Z1176:Abca8b UTSW 11 109961908 missense possibly damaging 0.52
Z1176:Abca8b UTSW 11 109974644 missense possibly damaging 0.87
Predicted Primers PCR Primer
(F):5'- CAGAATGGTGGTCATCTGAGGG -3'
(R):5'- TTTGGGGAAGAGATAAGCGCTC -3'

Sequencing Primer
(F):5'- GCTTTGGTACTTAGAGACCCTAGC -3'
(R):5'- CATTTAGATCAGTGACCTCAGCAGG -3'
Posted On 2015-06-10