Incidental Mutation 'R4176:D230025D16Rik'
ID319515
Institutional Source Beutler Lab
Gene Symbol D230025D16Rik
Ensembl Gene ENSMUSG00000031889
Gene NameRIKEN cDNA D230025D16 gene
SynonymsLin10
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location105225145-105253053 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105241131 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 218 (L218P)
Ref Sequence ENSEMBL: ENSMUSP00000034361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034361] [ENSMUST00000124113] [ENSMUST00000132964] [ENSMUST00000141957]
Predicted Effect probably benign
Transcript: ENSMUST00000034361
AA Change: L218P

PolyPhen 2 Score 0.088 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000034361
Gene: ENSMUSG00000031889
AA Change: L218P

DomainStartEndE-ValueType
Pfam:UPF0183 15 407 1.7e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124113
SMART Domains Protein: ENSMUSP00000119743
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 120 1.9e-52 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132964
SMART Domains Protein: ENSMUSP00000123583
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 1 117 1.4e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141957
SMART Domains Protein: ENSMUSP00000119148
Gene: ENSMUSG00000031889

DomainStartEndE-ValueType
Pfam:UPF0183 13 161 2.8e-65 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156561
Meta Mutation Damage Score 0.5600 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in D230025D16Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01935:D230025D16Rik APN 8 105240001 missense probably damaging 0.99
IGL02058:D230025D16Rik APN 8 105239709 missense probably damaging 1.00
IGL02162:D230025D16Rik APN 8 105239973 splice site probably benign
IGL02264:D230025D16Rik APN 8 105234546 missense possibly damaging 0.67
IGL02512:D230025D16Rik APN 8 105234478 splice site probably benign
FR4340:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4342:D230025D16Rik UTSW 8 105241098 missense probably benign
FR4589:D230025D16Rik UTSW 8 105241098 missense probably benign
R0564:D230025D16Rik UTSW 8 105239971 splice site probably benign
R1458:D230025D16Rik UTSW 8 105246556 critical splice donor site probably null
R1705:D230025D16Rik UTSW 8 105238472 splice site probably benign
R1860:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1861:D230025D16Rik UTSW 8 105240071 missense probably null 1.00
R1893:D230025D16Rik UTSW 8 105246501 missense probably damaging 1.00
R1969:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R2246:D230025D16Rik UTSW 8 105246500 missense possibly damaging 0.81
R3914:D230025D16Rik UTSW 8 105239983 missense probably benign 0.00
R4175:D230025D16Rik UTSW 8 105241131 missense probably benign 0.09
R4602:D230025D16Rik UTSW 8 105246888 missense possibly damaging 0.72
R5965:D230025D16Rik UTSW 8 105234539 missense probably damaging 1.00
R7717:D230025D16Rik UTSW 8 105251604 missense probably benign 0.12
R7787:D230025D16Rik UTSW 8 105231188 missense probably damaging 1.00
R7881:D230025D16Rik UTSW 8 105249452 missense probably benign 0.21
R7964:D230025D16Rik UTSW 8 105249452 missense probably benign 0.21
Z1088:D230025D16Rik UTSW 8 105231172 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGAGGAACATGAGCTTTG -3'
(R):5'- TGAAGGTACTAGAAGCTCTGCC -3'

Sequencing Primer
(F):5'- GAACATGAGCTTTGTACTAGGCCC -3'
(R):5'- AAGGTACTAGAAGCTCTGCCTTCTG -3'
Posted On2015-06-10