Incidental Mutation 'R4176:Jup'
ID319522
Institutional Source Beutler Lab
Gene Symbol Jup
Ensembl Gene ENSMUSG00000001552
Gene Namejunction plakoglobin
SynonymsPG, gamma-catenin, Ctnng, plakoglobin, D930025P04Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100368958-100397763 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 100372461 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 696 (D696V)
Ref Sequence ENSEMBL: ENSMUSP00000103026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001592] [ENSMUST00000107403]
Predicted Effect probably benign
Transcript: ENSMUST00000001592
AA Change: D696V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000001592
Gene: ENSMUSG00000001552
AA Change: D696V

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107403
AA Change: D696V

PolyPhen 2 Score 0.025 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000103026
Gene: ENSMUSG00000001552
AA Change: D696V

DomainStartEndE-ValueType
low complexity region 52 63 N/A INTRINSIC
ARM 132 171 3.58e1 SMART
ARM 172 214 4.03e1 SMART
ARM 215 255 1.07e-4 SMART
ARM 256 297 1.66e-1 SMART
ARM 299 340 1.86e1 SMART
ARM 341 381 9.23e-9 SMART
ARM 382 420 2.29e1 SMART
ARM 422 464 7.34e-3 SMART
ARM 469 510 8.3e-2 SMART
ARM 511 572 7.45e-4 SMART
ARM 573 613 5.35e-5 SMART
ARM 614 654 1.56e1 SMART
low complexity region 708 723 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124659
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151476
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152774
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a major cytoplasmic protein which is the only known constituent common to submembranous plaques of both desmosomes and intermediate junctions. This protein forms distinct complexes with cadherins and desmosomal cadherins and is a member of the catenin family since it contains a distinct repeating amino acid motif called the armadillo repeat. Mutation in this gene has been associated with Naxos disease. Alternative splicing occurs in this gene; however, not all transcripts have been fully described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants die with severe heart defects at embryonic day 10.5-16, depending on genetic background. Mutants that survive to birth exhibit skin blistering and subcorneal acantholysis associated with reduced number of desmosomes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Qrsl1 A T 10: 43,884,832 S252T probably damaging Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Jup
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Jup APN 11 100386249 missense probably benign
IGL01797:Jup APN 11 100381672 splice site probably benign
IGL01926:Jup APN 11 100383586 missense probably benign 0.00
IGL02030:Jup APN 11 100376991 missense probably damaging 0.96
IGL02073:Jup APN 11 100383389 splice site probably benign
IGL02218:Jup APN 11 100381839 missense probably damaging 1.00
IGL02450:Jup APN 11 100378357 missense probably damaging 1.00
IGL02955:Jup APN 11 100376739 missense probably benign 0.31
IGL02976:Jup APN 11 100378366 missense probably benign 0.40
IGL03023:Jup APN 11 100380692 splice site probably benign
IGL02802:Jup UTSW 11 100378378 missense probably benign
PIT4403001:Jup UTSW 11 100378087 critical splice donor site probably null
R0426:Jup UTSW 11 100372401 missense probably benign 0.02
R0626:Jup UTSW 11 100376763 missense probably benign
R1330:Jup UTSW 11 100372676 missense probably benign 0.02
R1437:Jup UTSW 11 100383576 missense probably benign 0.06
R1448:Jup UTSW 11 100383200 missense probably damaging 1.00
R1473:Jup UTSW 11 100379601 missense possibly damaging 0.79
R1686:Jup UTSW 11 100372434 missense probably damaging 0.96
R1824:Jup UTSW 11 100374137 nonsense probably null
R1875:Jup UTSW 11 100372294 unclassified probably null
R2017:Jup UTSW 11 100386341 missense probably benign 0.01
R2989:Jup UTSW 11 100376841 missense possibly damaging 0.92
R3881:Jup UTSW 11 100378381 missense probably benign
R3882:Jup UTSW 11 100378381 missense probably benign
R4612:Jup UTSW 11 100381834 missense probably damaging 0.98
R4808:Jup UTSW 11 100378192 missense probably damaging 0.99
R4854:Jup UTSW 11 100383041 missense possibly damaging 0.73
R4995:Jup UTSW 11 100379541 nonsense probably null
R5133:Jup UTSW 11 100383115 missense probably benign 0.02
R5408:Jup UTSW 11 100376781 missense probably damaging 1.00
R5641:Jup UTSW 11 100376806 missense possibly damaging 0.62
R5991:Jup UTSW 11 100379569 missense possibly damaging 0.59
R6431:Jup UTSW 11 100374341 missense probably benign 0.01
R6805:Jup UTSW 11 100383458 missense probably benign 0.17
R7022:Jup UTSW 11 100379553 missense probably damaging 1.00
R7203:Jup UTSW 11 100381734 missense probably damaging 1.00
R7399:Jup UTSW 11 100378351 missense possibly damaging 0.87
R7707:Jup UTSW 11 100383052 missense possibly damaging 0.90
R8019:Jup UTSW 11 100374197 missense not run
R8074:Jup UTSW 11 100386287 missense not run
Predicted Primers PCR Primer
(F):5'- TGGCAGTGTAACCATAGCAAC -3'
(R):5'- TGAGTGTGTGGAGCCCTAAC -3'

Sequencing Primer
(F):5'- TGGGGAAGGGGCCTTAC -3'
(R):5'- TGTGGAGCCCTAACCCAGAG -3'
Posted On2015-06-10