Incidental Mutation 'R4176:Qrsl1'
ID319519
Institutional Source Beutler Lab
Gene Symbol Qrsl1
Ensembl Gene ENSMUSG00000019863
Gene Nameglutaminyl-tRNA synthase (glutamine-hydrolyzing)-like 1
SynonymsGatA, 2700038P16Rik
MMRRC Submission 041014-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4176 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location43874188-43901745 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43884832 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 252 (S252T)
Ref Sequence ENSEMBL: ENSMUSP00000020012 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020012]
Predicted Effect probably damaging
Transcript: ENSMUST00000020012
AA Change: S252T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020012
Gene: ENSMUSG00000019863
AA Change: S252T

DomainStartEndE-ValueType
Pfam:Amidase 22 484 6e-129 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154405
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216786
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217541
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 96.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 T C 6: 128,545,037 E1274G possibly damaging Het
Abi3bp A G 16: 56,652,200 E424G probably damaging Het
Ankrd10 A G 8: 11,612,644 I363T probably benign Het
Ankrd12 A T 17: 66,027,366 N204K probably damaging Het
Brca2 C A 5: 150,539,633 S954* probably null Het
Col11a1 A C 3: 114,208,223 D432A possibly damaging Het
D230025D16Rik T C 8: 105,241,131 L218P probably benign Het
Dagla G T 19: 10,263,097 D256E probably damaging Het
Dsg2 T A 18: 20,580,663 F230L probably benign Het
Elp5 T C 11: 69,970,562 Q197R probably null Het
Emilin2 A T 17: 71,274,263 D489E probably benign Het
Ermp1 A G 19: 29,645,965 probably null Het
Fam149a A G 8: 45,341,284 Y614H probably benign Het
Fam189b T C 3: 89,184,447 V87A probably damaging Het
Fnbp1 T C 2: 31,036,119 probably null Het
Gabrb3 T C 7: 57,591,313 F13S probably benign Het
Gm884 T A 11: 103,536,600 H1388L unknown Het
Hydin G A 8: 110,593,820 A4499T probably benign Het
Islr2 A T 9: 58,199,900 C26S probably damaging Het
Jup T A 11: 100,372,461 D696V probably benign Het
Kcnq5 A C 1: 21,535,168 V171G probably damaging Het
Kntc1 T G 5: 123,776,617 S667A possibly damaging Het
Loxhd1 A G 18: 77,331,059 T293A possibly damaging Het
Lrp1b C A 2: 41,408,393 C138F probably damaging Het
Mctp2 A G 7: 72,259,337 I76T probably benign Het
Olfr180 T C 16: 58,916,584 D19G probably benign Het
Olfr372 A G 8: 72,058,184 Y168C probably damaging Het
Pbx1 A G 1: 168,191,272 probably null Het
Pelp1 A T 11: 70,396,867 W410R probably damaging Het
Pkd1 T C 17: 24,587,997 L3482P probably benign Het
Plekhn1 C T 4: 156,221,801 G604E probably benign Het
Ptpn22 A G 3: 103,886,245 T571A probably benign Het
Rab3gap2 T A 1: 185,246,666 M280K probably damaging Het
Serpinh1 T C 7: 99,346,999 M293V probably benign Het
Six4 G A 12: 73,108,831 T454I probably damaging Het
Slc26a8 T A 17: 28,647,999 E585D probably benign Het
Slc34a2 T G 5: 53,067,568 C350W probably damaging Het
Slit2 T A 5: 48,237,244 probably null Het
Trip11 G A 12: 101,895,698 Q203* probably null Het
Trpm7 T C 2: 126,829,163 K633R possibly damaging Het
Usp38 A C 8: 80,993,299 S434A probably benign Het
Zbtb16 A G 9: 48,659,801 F555S probably damaging Het
Zfp141 A T 7: 42,476,281 S256T probably benign Het
Other mutations in Qrsl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00477:Qrsl1 APN 10 43876492 missense probably damaging 1.00
IGL01724:Qrsl1 APN 10 43874608 missense probably benign 0.01
IGL01896:Qrsl1 APN 10 43876504 missense probably benign 0.02
IGL02192:Qrsl1 APN 10 43885014 missense probably damaging 1.00
IGL02239:Qrsl1 APN 10 43894600 missense possibly damaging 0.96
IGL02478:Qrsl1 APN 10 43882162 missense probably damaging 0.97
IGL02756:Qrsl1 APN 10 43882114 missense probably benign 0.00
IGL03386:Qrsl1 APN 10 43876550 missense possibly damaging 0.63
R0277:Qrsl1 UTSW 10 43896007 critical splice donor site probably null
R0323:Qrsl1 UTSW 10 43896007 critical splice donor site probably null
R0674:Qrsl1 UTSW 10 43896001 splice site probably benign
R1054:Qrsl1 UTSW 10 43882081 missense probably damaging 1.00
R1719:Qrsl1 UTSW 10 43896030 missense probably damaging 0.97
R1743:Qrsl1 UTSW 10 43881515 missense probably damaging 1.00
R1854:Qrsl1 UTSW 10 43894545 missense probably damaging 1.00
R2233:Qrsl1 UTSW 10 43896096 missense probably benign 0.00
R4452:Qrsl1 UTSW 10 43882162 missense probably damaging 1.00
R4732:Qrsl1 UTSW 10 43876663 missense probably damaging 1.00
R4733:Qrsl1 UTSW 10 43876663 missense probably damaging 1.00
R5626:Qrsl1 UTSW 10 43881520 missense probably benign 0.00
R6159:Qrsl1 UTSW 10 43882193 missense probably benign 0.00
R7563:Qrsl1 UTSW 10 43876517 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGGAAAGTCTACAGAGCC -3'
(R):5'- TGGTGAATTCAATGGACGTGCC -3'

Sequencing Primer
(F):5'- AGTCTACAGAGCCTTGCTTTATAGG -3'
(R):5'- CAGGAATCCTCACCAGATGTGTG -3'
Posted On2015-06-10