Incidental Mutation 'R4235:Tnfaip6'
ID321046
Institutional Source Beutler Lab
Gene Symbol Tnfaip6
Ensembl Gene ENSMUSG00000053475
Gene Nametumor necrosis factor alpha induced protein 6
SynonymsTnfip6, TSG-6, Tsg6
MMRRC Submission 041052-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R4235 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location52038009-52056686 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 52050864 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 139 (F139S)
Ref Sequence ENSEMBL: ENSMUSP00000069231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065927]
Predicted Effect probably damaging
Transcript: ENSMUST00000065927
AA Change: F139S

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069231
Gene: ENSMUSG00000053475
AA Change: F139S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
LINK 34 129 1.06e-53 SMART
CUB 135 247 2.66e-47 SMART
Meta Mutation Damage Score 0.3042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 97% (68/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a secretory protein that contains a hyaluronan-binding domain, and thus is a member of the hyaluronan-binding protein family. The hyaluronan-binding domain is known to be involved in extracellular matrix stability and cell migration. This protein has been shown to form a stable complex with inter-alpha-inhibitor (I alpha I), and thus enhance the serine protease inhibitory activity of I alpha I, which is important in the protease network associated with inflammation. This gene can be induced by proinflammatory cytokines such as tumor necrosis factor alpha and interleukin-1. Enhanced levels of this protein are found in the synovial fluid of patients with osteoarthritis and rheumatoid arthritis.[provided by RefSeq, Dec 2010]
PHENOTYPE: Females lacking functional copies of this gene are infertile due to failed cumulus-oocyte complex expansion. Mice show attenuated acute allergic pulmonary inflammation and are resistant to induction of airway hyperresponsiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930567H17Rik C T X: 70,394,529 A53T probably benign Het
5730596B20Rik G T 6: 52,178,961 probably benign Het
9530053A07Rik T A 7: 28,156,648 D1953E probably damaging Het
Akap6 T A 12: 53,139,671 N1289K probably damaging Het
Arhgap21 A G 2: 20,887,137 V161A probably damaging Het
Arhgef18 T C 8: 3,450,317 I541T possibly damaging Het
Atp7b A G 8: 22,011,023 Y955H possibly damaging Het
Bnc2 A G 4: 84,293,514 V231A probably damaging Het
Bod1l A G 5: 41,821,455 S839P probably damaging Het
Casp8 T A 1: 58,833,698 H264Q possibly damaging Het
Cc2d1b A T 4: 108,625,352 probably benign Het
Cpne6 A T 14: 55,513,600 probably benign Het
Ddx1 C T 12: 13,223,857 V590I possibly damaging Het
Dgkd T A 1: 87,931,982 L774* probably null Het
Fbxl2 T A 9: 113,989,163 N205I probably benign Het
Fkbp15 A T 4: 62,336,456 I269K probably benign Het
Gm13023 G C 4: 143,794,774 C320S probably damaging Het
Gm26678 T C 3: 54,633,083 noncoding transcript Het
Has1 G T 17: 17,850,036 R208S possibly damaging Het
Hecw1 C G 13: 14,317,139 A423P probably benign Het
Hspa12b T C 2: 131,139,012 V162A probably benign Het
Ifi208 T G 1: 173,682,911 S211A probably benign Het
Ighv6-3 T C 12: 114,391,874 E65G probably damaging Het
Igkv9-120 A T 6: 68,050,333 D77V probably benign Het
Impg1 A G 9: 80,345,329 L523P probably damaging Het
Ip6k2 G A 9: 108,805,648 R319Q probably benign Het
Kdm2a A G 19: 4,322,521 I932T probably damaging Het
Krt17 T C 11: 100,257,868 T279A possibly damaging Het
Lamp1 T C 8: 13,167,192 V67A possibly damaging Het
Limk1 T C 5: 134,670,478 I142V probably benign Het
Mamdc2 T C 19: 23,374,017 N182D possibly damaging Het
Mcpt1 G A 14: 56,018,560 probably null Het
Med12l T G 3: 59,257,223 probably null Het
Mfsd10 G T 5: 34,635,625 T44N probably damaging Het
Mrps27 T C 13: 99,405,041 S218P probably damaging Het
Mrps30 T C 13: 118,386,840 D132G probably damaging Het
Neil2 A C 14: 63,191,841 M1R probably null Het
Nelfcd T C 2: 174,427,048 F587L probably damaging Het
Nfil3 T C 13: 52,968,799 D23G probably benign Het
Nit2 T C 16: 57,157,160 K169R probably benign Het
Nxt1 T C 2: 148,675,347 S3P probably benign Het
Ogt A G X: 101,667,525 N434D probably damaging Het
Olfr679 T A 7: 105,085,787 S24T possibly damaging Het
Pcdhga5 A G 18: 37,695,948 D483G possibly damaging Het
Ralgapa1 C T 12: 55,640,644 R2019Q probably damaging Het
Rsl1 T C 13: 67,177,162 probably null Het
Sobp G A 10: 43,022,900 H230Y probably damaging Het
Sptan1 A G 2: 30,026,588 E2096G probably damaging Het
Tie1 G T 4: 118,478,405 S797* probably null Het
Tmem266 T C 9: 55,418,107 I186T probably damaging Het
Tmem38b T C 4: 53,840,710 C66R probably damaging Het
Tnrc6a T C 7: 123,171,680 S898P probably benign Het
Trim24 A G 6: 37,964,740 D911G probably damaging Het
Tyw5 T C 1: 57,388,488 probably benign Het
Ubr3 C T 2: 70,016,385 Q1651* probably null Het
Unc13c T A 9: 73,530,952 I1943F possibly damaging Het
Usp47 T A 7: 112,110,048 S1334T probably damaging Het
Vmn1r215 T A 13: 23,075,931 V47E probably benign Het
Vmn1r224 T A 17: 20,419,362 M67K possibly damaging Het
Wdfy3 T A 5: 101,922,634 probably null Het
Zfc3h1 T C 10: 115,418,799 Y1433H probably benign Het
Other mutations in Tnfaip6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Tnfaip6 APN 2 52055847 missense probably damaging 1.00
IGL01565:Tnfaip6 APN 2 52055834 missense probably damaging 1.00
R0118:Tnfaip6 UTSW 2 52043815 nonsense probably null
R0279:Tnfaip6 UTSW 2 52055916 missense possibly damaging 0.95
R2138:Tnfaip6 UTSW 2 52052332 missense possibly damaging 0.51
R2152:Tnfaip6 UTSW 2 52043730 missense probably damaging 1.00
R2240:Tnfaip6 UTSW 2 52050914 missense probably benign 0.16
R3877:Tnfaip6 UTSW 2 52052327 missense probably benign 0.27
R4857:Tnfaip6 UTSW 2 52051074 splice site probably null
R5658:Tnfaip6 UTSW 2 52051035 missense possibly damaging 0.66
R6476:Tnfaip6 UTSW 2 52052316 missense probably benign
R6657:Tnfaip6 UTSW 2 52043783 missense probably damaging 1.00
R7424:Tnfaip6 UTSW 2 52038216 missense probably benign 0.00
R7980:Tnfaip6 UTSW 2 52051058 missense probably damaging 1.00
R8353:Tnfaip6 UTSW 2 52055867 missense probably benign 0.00
R8453:Tnfaip6 UTSW 2 52055867 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCAAACAATAGCCAGGCATG -3'
(R):5'- GCCGTGGACGTCATCATAACTG -3'

Sequencing Primer
(F):5'- TGGTTACACACACACACAGAGAGAG -3'
(R):5'- CGTGGACGTCATCATAACTGTCATAG -3'
Posted On2015-06-12