Incidental Mutation 'R4378:Olfr1165-ps'
ID325179
Institutional Source Beutler Lab
Gene Symbol Olfr1165-ps
Ensembl Gene ENSMUSG00000046590
Gene Nameolfactory receptor 1165, pseudogene
SynonymsGA_x6K02T2Q125-49593880-49592930, MOR174-7
MMRRC Submission 041121-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.097) question?
Stock #R4378 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location88101036-88101985 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 88101485 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 167 (N167K)
Ref Sequence ENSEMBL: ENSMUSP00000149054 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000117860
AA Change: N167K
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A G 11: 9,293,644 K1836E probably benign Het
Adora1 A G 1: 134,203,210 F241S probably damaging Het
Akt1s1 C T 7: 44,853,960 T168M probably damaging Het
Amigo1 C T 3: 108,191,753 probably benign Het
Amigo2 A G 15: 97,245,978 F188L possibly damaging Het
Armc2 T C 10: 41,993,082 T29A possibly damaging Het
Axl G A 7: 25,758,837 A822V probably benign Het
Borcs5 T C 6: 134,644,329 V21A probably benign Het
Cdc42ep3 A G 17: 79,334,979 S171P probably benign Het
Cmas T C 6: 142,772,285 probably benign Het
Cyp4f40 A G 17: 32,668,029 N158S probably null Het
Dnah6 G T 6: 73,118,026 N2139K probably benign Het
Elmo1 A T 13: 20,373,116 H409L possibly damaging Het
Exoc4 T A 6: 33,815,687 V584E probably damaging Het
Gm7271 A G 5: 76,500,533 K62R probably damaging Het
Gm9116 A G 3: 93,910,479 noncoding transcript Het
Gxylt2 A G 6: 100,733,200 S101G probably benign Het
Hsph1 C A 5: 149,636,007 E24* probably null Het
Ighv1-56 C T 12: 115,242,948 E50K probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lrriq1 A T 10: 103,202,364 D859E probably damaging Het
Mapk7 G A 11: 61,493,667 S71L probably damaging Het
Nars A G 18: 64,501,353 Y500H probably damaging Het
Olfr3 T C 2: 36,812,469 M208V probably benign Het
Phc1 T C 6: 122,335,007 N64S possibly damaging Het
Ppp4r3b T A 11: 29,209,450 N180K possibly damaging Het
Primpol G A 8: 46,576,183 probably benign Het
Prtg T C 9: 72,842,760 S149P possibly damaging Het
Qrich2 T C 11: 116,446,915 S1916G probably damaging Het
Rps6ka5 A T 12: 100,597,937 Y218N probably damaging Het
Setbp1 T C 18: 78,856,618 D1278G possibly damaging Het
Sirt1 C T 10: 63,338,949 A8T probably benign Het
Sobp C T 10: 43,021,304 V762I probably damaging Het
Sptan1 T C 2: 30,025,569 S1994P probably damaging Het
Taok3 T C 5: 117,209,571 I87T probably damaging Het
Tecta T C 9: 42,366,708 Y1168C probably damaging Het
Trhr A G 15: 44,197,627 Y181C probably damaging Het
Ube4b C T 4: 149,383,798 D174N probably damaging Het
Ubr4 C T 4: 139,410,440 H1067Y possibly damaging Het
Vmn2r86 A G 10: 130,452,600 I344T possibly damaging Het
Vmn2r88 T A 14: 51,413,289 L153* probably null Het
Zfp516 T A 18: 82,987,180 D736E probably benign Het
Zfp612 G T 8: 110,089,051 V258F possibly damaging Het
Other mutations in Olfr1165-ps
AlleleSourceChrCoordTypePredicted EffectPPH Score
R5078:Olfr1165-ps UTSW 2 88101535 missense probably benign 0.03
R6373:Olfr1165-ps UTSW 2 88101845 missense possibly damaging 0.73
R6698:Olfr1165-ps UTSW 2 88101217 missense unknown
R6736:Olfr1165-ps UTSW 2 88101603 missense probably benign 0.03
R7164:Olfr1165-ps UTSW 2 88101832 missense probably damaging 0.97
R7285:Olfr1165-ps UTSW 2 88101705 missense probably damaging 1.00
R7807:Olfr1165-ps UTSW 2 88101565 missense probably benign 0.00
R8040:Olfr1165-ps UTSW 2 88101359 missense unknown
R8509:Olfr1165-ps UTSW 2 88101522 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- AGTCCACCCTTAGAAGGCATC -3'
(R):5'- CAATCTCTTTCAAAGGATGCATGAC -3'

Sequencing Primer
(F):5'- GTCCACCCTTAGAAGGCATCTTAATG -3'
(R):5'- TGCATTTGTGATTACGGAAATGTTC -3'
Posted On2015-07-06