Incidental Mutation 'R4450:Cdca4'
ID328941
Institutional Source Beutler Lab
Gene Symbol Cdca4
Ensembl Gene ENSMUSG00000047832
Gene Namecell division cycle associated 4
Synonyms2410018C03Rik, SEI-3, Hepp
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.611) question?
Stock #R4450 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location112820229-112829423 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 112821658 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 150 (N150S)
Ref Sequence ENSEMBL: ENSMUSP00000152315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000062092] [ENSMUST00000220899]
Predicted Effect probably benign
Transcript: ENSMUST00000062092
AA Change: N150S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000058901
Gene: ENSMUSG00000047832
AA Change: N150S

DomainStartEndE-ValueType
Pfam:SERTA 33 70 9.1e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220899
AA Change: N150S

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0605 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the E2F family of transcription factors. This protein regulates E2F-dependent transcriptional activation and cell proliferation, mainly through the E2F/retinoblastoma protein pathway. It also functions in the regulation of JUN oncogene expression. This protein shows distinctive nuclear-mitotic apparatus distribution, it is involved in spindle organization from prometaphase, and may also play a role as a midzone factor involved in chromosome segregation or cytokinesis. Two alternatively spliced transcript variants encoding the same protein have been noted for this gene. Two pseudogenes have also been identified on chromosome 1. [provided by RefSeq, May 2014]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Klhl42 G A 6: 147,091,671 G47D probably benign Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Cdca4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02839:Cdca4 APN 12 112821891 missense probably damaging 1.00
R1372:Cdca4 UTSW 12 112821917 nonsense probably null
R4410:Cdca4 UTSW 12 112821879 missense probably benign 0.00
R4835:Cdca4 UTSW 12 112821547 missense probably damaging 1.00
R5062:Cdca4 UTSW 12 112821863 missense probably benign 0.02
R5907:Cdca4 UTSW 12 112821719 missense probably benign 0.00
R7097:Cdca4 UTSW 12 112821569 missense probably benign 0.31
R8679:Cdca4 UTSW 12 112822114 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- AGACTTGCAAGTGGAACTGG -3'
(R):5'- CCAGAATGTAGATCGGGCAC -3'

Sequencing Primer
(F):5'- TGCAGCAAAGCCCTCAAGG -3'
(R):5'- AGTTGAACGCCTGGTGTCC -3'
Posted On2015-07-21