Incidental Mutation 'R4450:Klhl42'
ID381245
Institutional Source Beutler Lab
Gene Symbol Klhl42
Ensembl Gene ENSMUSG00000040102
Gene Namekelch-like 42
SynonymsKlhdc5, C230080I20Rik
MMRRC Submission 041711-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4450 (G1)
Quality Score61
Status Validated
Chromosome6
Chromosomal Location147091379-147112778 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147091671 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 47 (G47D)
Ref Sequence ENSEMBL: ENSMUSP00000042558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036003] [ENSMUST00000100780] [ENSMUST00000123367]
Predicted Effect probably benign
Transcript: ENSMUST00000036003
AA Change: G47D

PolyPhen 2 Score 0.161 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000042558
Gene: ENSMUSG00000040102
AA Change: G47D

DomainStartEndE-ValueType
BTB 5 145 1.14e-1 SMART
low complexity region 151 164 N/A INTRINSIC
Kelch 242 289 1.79e-5 SMART
Kelch 290 332 1.25e-9 SMART
Kelch 333 379 1.56e1 SMART
Blast:Kelch 380 437 3e-31 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000100780
SMART Domains Protein: ENSMUSP00000098343
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 5.4e-34 SMART
low complexity region 263 274 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123367
SMART Domains Protein: ENSMUSP00000144765
Gene: ENSMUSG00000072662

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
MANEC 24 113 9.4e-40 SMART
Meta Mutation Damage Score 0.1740 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.0%
Validation Efficiency 98% (43/44)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3930402G23Rik T A 8: 10,926,129 noncoding transcript Het
Acsl6 A G 11: 54,328,403 D278G probably damaging Het
Adamdec1 C T 14: 68,573,119 R196Q probably benign Het
Akap13 T A 7: 75,742,760 F2450L probably damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Angel1 A T 12: 86,721,924 Y262N probably damaging Het
Arhgef18 A G 8: 3,437,097 E272G probably damaging Het
Bpifb6 A G 2: 153,906,768 E228G possibly damaging Het
Brca2 T G 5: 150,536,053 D264E probably damaging Het
Cdca4 T C 12: 112,821,658 N150S probably benign Het
Cep162 T C 9: 87,225,808 S510G probably damaging Het
Cldn12 T C 5: 5,508,398 T10A probably damaging Het
Clip2 C T 5: 134,502,953 G631D possibly damaging Het
Col19a1 T A 1: 24,322,035 T625S probably damaging Het
Col6a5 C T 9: 105,904,521 G1635D unknown Het
Dcp1b A G 6: 119,206,476 T175A probably benign Het
Eln C T 5: 134,725,781 probably benign Het
Galnt2 A G 8: 124,295,377 D14G probably benign Het
Gm9894 T A 13: 67,765,080 noncoding transcript Het
Herc2 T C 7: 56,227,892 L4569P probably damaging Het
Hrasls C T 16: 29,228,224 T165M possibly damaging Het
Iqcm T C 8: 75,629,766 S176P probably damaging Het
Lmo2 T C 2: 103,981,062 Y147H probably damaging Het
Lzts2 A T 19: 45,023,593 K154* probably null Het
Map4k3 C T 17: 80,603,982 probably null Het
Mlc1 A G 15: 88,963,490 F285S probably benign Het
Myo5a T A 9: 75,167,176 M789K probably benign Het
Nbeal1 T A 1: 60,267,774 S319T probably damaging Het
Nsun4 A T 4: 116,051,256 Y702* probably null Het
Olfr917 A T 9: 38,665,754 V30E probably benign Het
Olfr954 G A 9: 39,462,032 M200I probably benign Het
Osbpl5 T A 7: 143,694,906 T640S probably benign Het
Rangrf A T 11: 68,975,184 probably benign Het
Rnpc3 T C 3: 113,611,137 probably benign Het
Ros1 C T 10: 52,077,942 G1867D probably damaging Het
Slc11a1 C A 1: 74,385,535 probably benign Het
Slc15a4 A G 5: 127,604,536 probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Syt6 A G 3: 103,585,645 H156R probably benign Het
Tln2 C T 9: 67,344,065 probably null Het
Trim58 T C 11: 58,651,365 W384R probably benign Het
Wwc2 A G 8: 47,868,667 Y471H unknown Het
Other mutations in Klhl42
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Klhl42 APN 6 147101733 missense probably damaging 1.00
IGL01401:Klhl42 APN 6 147107743 missense probably benign 0.03
IGL02590:Klhl42 APN 6 147092312 missense probably damaging 0.97
R0045:Klhl42 UTSW 6 147092168 missense probably benign
R1066:Klhl42 UTSW 6 147107899 missense probably benign
R1920:Klhl42 UTSW 6 147107929 missense probably damaging 1.00
R1951:Klhl42 UTSW 6 147091823 missense probably damaging 0.99
R2017:Klhl42 UTSW 6 147107793 missense probably benign 0.04
R2021:Klhl42 UTSW 6 147091896 missense possibly damaging 0.59
R2065:Klhl42 UTSW 6 147101663 missense probably damaging 1.00
R2128:Klhl42 UTSW 6 147101753 missense probably benign 0.00
R2982:Klhl42 UTSW 6 147091616 missense probably damaging 1.00
R3415:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3416:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R3417:Klhl42 UTSW 6 147107880 missense probably damaging 1.00
R4967:Klhl42 UTSW 6 147108004 missense possibly damaging 0.77
R5342:Klhl42 UTSW 6 147092286 missense possibly damaging 0.86
R5556:Klhl42 UTSW 6 147108112 missense probably benign 0.00
R6269:Klhl42 UTSW 6 147092307 missense probably damaging 1.00
R7375:Klhl42 UTSW 6 147092040 missense probably benign
R7769:Klhl42 UTSW 6 147091860 missense possibly damaging 0.95
R7848:Klhl42 UTSW 6 147108100 missense probably damaging 1.00
R7931:Klhl42 UTSW 6 147108100 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGAGGCCGTTTACTCG -3'
(R):5'- ACAACAGTAGCGGGAATTGC -3'

Sequencing Primer
(F):5'- TACTCGGAGGGCGTGTGAC -3'
(R):5'- TACAGCTCCAGGCAGTTGC -3'
Posted On2016-04-22