Incidental Mutation 'R4588:Cpne5'
ID342636
Institutional Source Beutler Lab
Gene Symbol Cpne5
Ensembl Gene ENSMUSG00000024008
Gene Namecopine V
Synonyms
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4588 (G1)
Quality Score120
Status Validated
Chromosome17
Chromosomal Location29156550-29237797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29164713 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 327 (I327V)
Ref Sequence ENSEMBL: ENSMUSP00000024805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024805]
Predicted Effect probably benign
Transcript: ENSMUST00000024805
AA Change: I327V

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000024805
Gene: ENSMUSG00000024008
AA Change: I327V

DomainStartEndE-ValueType
C2 23 131 2.09e-9 SMART
C2 161 283 1.88e-11 SMART
low complexity region 290 297 N/A INTRINSIC
VWA 326 519 1.52e-13 SMART
low complexity region 564 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124917
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126993
Meta Mutation Damage Score 0.2218 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: Calcium-dependent membrane-binding proteins may regulate molecular events at the interface of the cell membrane and cytoplasm. This gene is one of several genes that encodes a calcium-dependent protein containing two N-terminal type II C2 domains and an integrin A domain-like sequence in the C-terminus. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Sstr1 G T 12: 58,213,631 A347S probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Cpne5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02626:Cpne5 APN 17 29160337 missense probably damaging 1.00
R0329:Cpne5 UTSW 17 29211660 missense probably damaging 1.00
R0330:Cpne5 UTSW 17 29211660 missense probably damaging 1.00
R0462:Cpne5 UTSW 17 29176189 missense probably benign 0.12
R0699:Cpne5 UTSW 17 29209693 missense probably damaging 1.00
R0891:Cpne5 UTSW 17 29202919 splice site probably benign
R1872:Cpne5 UTSW 17 29204693 missense probably benign 0.12
R2167:Cpne5 UTSW 17 29162332 missense probably damaging 1.00
R3901:Cpne5 UTSW 17 29159108 missense unknown
R4037:Cpne5 UTSW 17 29159113 missense unknown
R4478:Cpne5 UTSW 17 29209476 missense probably damaging 0.99
R4853:Cpne5 UTSW 17 29161198 missense probably benign 0.01
R5630:Cpne5 UTSW 17 29226216 missense probably damaging 1.00
R5686:Cpne5 UTSW 17 29184017 missense possibly damaging 0.83
R7019:Cpne5 UTSW 17 29226222 missense probably damaging 1.00
R7086:Cpne5 UTSW 17 29159077 missense unknown
R7472:Cpne5 UTSW 17 29204740 missense probably benign 0.02
R7596:Cpne5 UTSW 17 29226217 missense possibly damaging 0.90
R7649:Cpne5 UTSW 17 29226198 missense probably damaging 1.00
R7787:Cpne5 UTSW 17 29188287 splice site probably null
R8406:Cpne5 UTSW 17 29209481 missense probably benign 0.00
R8444:Cpne5 UTSW 17 29188383 missense probably benign 0.07
R8795:Cpne5 UTSW 17 29204688 critical splice donor site probably benign
R8821:Cpne5 UTSW 17 29211694 missense probably benign 0.00
Z1177:Cpne5 UTSW 17 29159182 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTAGCTCTGCCTTCTCTGG -3'
(R):5'- AATGCACCCCTCCGATGC -3'

Sequencing Primer
(F):5'- CTAGGTTGTCACCCACATTGAAGTG -3'
(R):5'- CTCCGATGCCCGCAGAG -3'
Posted On2015-09-24