Incidental Mutation 'R4588:Sstr1'
ID342630
Institutional Source Beutler Lab
Gene Symbol Sstr1
Ensembl Gene ENSMUSG00000035431
Gene Namesomatostatin receptor 1
SynonymsSmstr-1, sst1, Smstr1
MMRRC Submission 042007-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4588 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location58211772-58214444 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 58213631 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 347 (A347S)
Ref Sequence ENSEMBL: ENSMUSP00000106299 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044299] [ENSMUST00000110671]
Predicted Effect probably benign
Transcript: ENSMUST00000044299
AA Change: A347S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000037045
Gene: ENSMUSG00000035431
AA Change: A347S

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 297 4.9e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 2.2e-65 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110671
AA Change: A347S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000106299
Gene: ENSMUSG00000035431
AA Change: A347S

DomainStartEndE-ValueType
low complexity region 8 20 N/A INTRINSIC
Pfam:7TM_GPCR_Srx 66 299 4.8e-8 PFAM
Pfam:7TM_GPCR_Srsx 69 338 2.7e-14 PFAM
Pfam:7tm_1 75 323 4.1e-70 PFAM
Pfam:7TM_GPCR_Srv 131 339 1.8e-11 PFAM
Meta Mutation Damage Score 0.0928 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatins are peptide hormones that regulate diverse cellular functions such as neurotransmission, cell proliferation, and endocrine signaling as well as inhibiting the release of many hormones and other secretory proteins. Somatostatin has two active forms of 14 and 28 amino acids. The biological effects of somatostatins are mediated by a family of G-protein coupled somatostatin receptors that are expressed in a tissue-specific manner. The protein encoded by this gene is a member of the superfamily of somatostatin receptors having seven transmembrane segments. Somatostatin receptors form homodimers and heterodimers with other members of the superfamily as well as with other G-protein coupled receptors and receptor tyrosine kinases. This somatostatin receptor has greater affinity for somatostatin-14 than -28. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display abnormal eye electrophysiology. Mice homozygous for a second targeted mutation display hypoactivity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,997,867 probably null Het
Abcb4 A T 5: 8,947,328 I936F probably benign Het
Adnp2 G T 18: 80,128,648 L849I probably benign Het
Atf7ip T C 6: 136,599,694 S1032P probably benign Het
Atr A C 9: 95,865,667 D334A probably benign Het
Atrip A T 9: 109,060,279 D20E probably damaging Het
Atxn7 T A 14: 14,096,268 C43* probably null Het
Cfap65 C A 1: 74,904,056 Q1603H possibly damaging Het
Cpne5 T C 17: 29,164,713 I327V probably benign Het
Ctsa T C 2: 164,834,150 S41P possibly damaging Het
Cyp4x1 A T 4: 115,108,797 L444Q probably damaging Het
Dchs1 C A 7: 105,756,041 M2431I probably benign Het
Ddi1 T A 9: 6,266,003 H122L probably benign Het
Defa21 C T 8: 21,025,648 P21S probably damaging Het
Ect2 A G 3: 27,147,000 V77A probably damaging Het
Ermap C A 4: 119,188,248 probably benign Het
Fancm G A 12: 65,118,441 probably null Het
Gcnt3 T A 9: 70,034,230 D352V probably damaging Het
Gys2 A G 6: 142,449,455 M428T possibly damaging Het
Igtp T A 11: 58,206,682 N226K probably damaging Het
Itpr2 T A 6: 146,241,196 H1675L probably benign Het
Lipo4 G A 19: 33,499,247 P367L possibly damaging Het
Lzts3 T C 2: 130,634,766 *587W probably null Het
Mast3 T A 8: 70,780,607 K300* probably null Het
Mepce G A 5: 137,785,272 T264I possibly damaging Het
Mif4gd A T 11: 115,609,546 I62N probably damaging Het
Olfr307 C T 7: 86,335,644 V251I probably benign Het
Olfr869 T A 9: 20,138,087 *324K probably null Het
Palm3 A G 8: 84,029,386 K509R probably benign Het
Pde11a T C 2: 76,029,303 T821A probably damaging Het
Pik3r5 A G 11: 68,493,261 probably benign Het
Pkhd1 T C 1: 20,200,868 T3154A probably benign Het
Ptprs A G 17: 56,425,534 Y438H probably damaging Het
Rdh8 T A 9: 20,822,729 D70E probably benign Het
Scn2a A T 2: 65,713,767 I831L possibly damaging Het
Selenoo A G 15: 89,096,718 H420R probably benign Het
Slc22a16 T C 10: 40,570,681 probably benign Het
Slc5a1 A G 5: 33,145,288 T208A probably benign Het
Sparc T C 11: 55,405,236 M121V probably benign Het
Stab1 C A 14: 31,157,445 V693F probably benign Het
Tnn A G 1: 160,145,111 V307A probably benign Het
Trmt1 A G 8: 84,690,753 probably benign Het
Ttc3 T C 16: 94,442,901 S1255P probably benign Het
Ube2ql1 A C 13: 69,739,157 S62A unknown Het
Vmn2r84 T A 10: 130,385,940 M804L probably damaging Het
Vps13a T C 19: 16,640,039 T3002A probably damaging Het
Vps50 A G 6: 3,562,306 E467G probably damaging Het
Other mutations in Sstr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Sstr1 APN 12 58212750 missense probably benign
IGL01975:Sstr1 APN 12 58213626 missense probably benign 0.01
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0019:Sstr1 UTSW 12 58213149 missense probably damaging 1.00
R0026:Sstr1 UTSW 12 58212858 missense probably damaging 1.00
R0083:Sstr1 UTSW 12 58213742 missense possibly damaging 0.85
R1218:Sstr1 UTSW 12 58213620 missense possibly damaging 0.68
R1254:Sstr1 UTSW 12 58213322 missense possibly damaging 0.93
R1815:Sstr1 UTSW 12 58213478 missense possibly damaging 0.81
R2318:Sstr1 UTSW 12 58212776 missense possibly damaging 0.77
R5041:Sstr1 UTSW 12 58213155 missense possibly damaging 0.94
R6556:Sstr1 UTSW 12 58213692 missense possibly damaging 0.94
R7332:Sstr1 UTSW 12 58213386 missense probably damaging 1.00
R7342:Sstr1 UTSW 12 58213670 missense possibly damaging 0.95
R7380:Sstr1 UTSW 12 58213280 missense probably benign 0.01
R7452:Sstr1 UTSW 12 58213356 missense probably damaging 1.00
R7873:Sstr1 UTSW 12 58213527 missense probably damaging 1.00
Z1176:Sstr1 UTSW 12 58213526 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- TTTCTACGTGGTACAGCTGGTC -3'
(R):5'- CTGGTGTCGGGTTACCATTC -3'

Sequencing Primer
(F):5'- ACAGCTGGTCAACGTGTTC -3'
(R):5'- GTGTCGGGTTACCATTCCCTCC -3'
Posted On2015-09-24