Incidental Mutation 'R4588:Dchs1'
ID 342613
Institutional Source Beutler Lab
Gene Symbol Dchs1
Ensembl Gene ENSMUSG00000036862
Gene Name dachsous cadherin related 1
Synonyms C130033F22Rik, 3110041P15Rik
MMRRC Submission 042007-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4588 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 105402197-105436861 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 105405248 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Isoleucine at position 2431 (M2431I)
Ref Sequence ENSEMBL: ENSMUSP00000077574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033184] [ENSMUST00000078482] [ENSMUST00000210066]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000033184
SMART Domains Protein: ENSMUSP00000033184
Gene: ENSMUSG00000030894

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pro-kuma_activ 32 176 4.53e-50 SMART
low complexity region 177 189 N/A INTRINSIC
Pfam:Peptidase_S8 251 492 1.1e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000078482
AA Change: M2431I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000077574
Gene: ENSMUSG00000036862
AA Change: M2431I

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
CA 58 135 5.2e-11 SMART
CA 159 247 6.1e-17 SMART
CA 271 354 2.6e-30 SMART
CA 382 464 7.8e-26 SMART
CA 489 570 1.2e-34 SMART
CA 594 677 1.9e-27 SMART
CA 701 782 5.3e-11 SMART
CA 806 886 1e-12 SMART
CA 910 990 3.3e-14 SMART
CA 1016 1097 3.6e-18 SMART
CA 1121 1203 3.1e-34 SMART
CA 1233 1307 8.8e-16 SMART
low complexity region 1323 1335 N/A INTRINSIC
CA 1344 1427 9.9e-9 SMART
CA 1451 1537 1.5e-23 SMART
CA 1560 1640 7.2e-32 SMART
CA 1664 1742 1.8e-31 SMART
CA 1765 1846 7.8e-30 SMART
CA 1870 1951 3.7e-26 SMART
low complexity region 1957 1965 N/A INTRINSIC
CA 1979 2059 1.1e-6 SMART
CA 2083 2162 2.7e-18 SMART
CA 2186 2268 2.2e-26 SMART
CA 2291 2367 1e-18 SMART
CA 2391 2473 1.8e-23 SMART
CA 2497 2593 3.5e-21 SMART
CA 2617 2697 1.2e-25 SMART
CA 2721 2804 1.9e-18 SMART
CA 2828 2919 3e-3 SMART
transmembrane domain 2932 2954 N/A INTRINSIC
low complexity region 3001 3017 N/A INTRINSIC
low complexity region 3046 3055 N/A INTRINSIC
low complexity region 3088 3097 N/A INTRINSIC
low complexity region 3185 3196 N/A INTRINSIC
low complexity region 3237 3259 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000140959
Predicted Effect probably benign
Transcript: ENSMUST00000210066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210395
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210730
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210840
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211226
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211560
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211659
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 98% (51/52)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the cadherin superfamily whose members encode calcium-dependent cell-cell adhesion molecules. The encoded protein has a signal peptide, 27 cadherin repeat domains and a unique cytoplasmic region. This particular cadherin family member is expressed in fibroblasts but not in melanocytes or keratinocytes. The cell-cell adhesion of fibroblasts is thought to be necessary for wound healing. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit postnatal lethality, growth retardation, small lungs, abnormal cochlea morphology, abnormal kidney morphology, cardiovascular abnormalities and skeletal abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 G T 10: 79,833,701 (GRCm39) probably null Het
Abcb4 A T 5: 8,997,328 (GRCm39) I936F probably benign Het
Adnp2 G T 18: 80,171,863 (GRCm39) L849I probably benign Het
Atf7ip T C 6: 136,576,692 (GRCm39) S1032P probably benign Het
Atr A C 9: 95,747,720 (GRCm39) D334A probably benign Het
Atrip A T 9: 108,889,347 (GRCm39) D20E probably damaging Het
Atxn7 T A 14: 14,096,268 (GRCm38) C43* probably null Het
Cfap65 C A 1: 74,943,215 (GRCm39) Q1603H possibly damaging Het
Cpne5 T C 17: 29,383,687 (GRCm39) I327V probably benign Het
Ctsa T C 2: 164,676,070 (GRCm39) S41P possibly damaging Het
Cyp4x1 A T 4: 114,965,994 (GRCm39) L444Q probably damaging Het
Ddi1 T A 9: 6,266,003 (GRCm39) H122L probably benign Het
Defa21 C T 8: 21,515,664 (GRCm39) P21S probably damaging Het
Ect2 A G 3: 27,201,149 (GRCm39) V77A probably damaging Het
Ermap C A 4: 119,045,445 (GRCm39) probably benign Het
Fancm G A 12: 65,165,215 (GRCm39) probably null Het
Gcnt3 T A 9: 69,941,512 (GRCm39) D352V probably damaging Het
Gys2 A G 6: 142,395,181 (GRCm39) M428T possibly damaging Het
Igtp T A 11: 58,097,508 (GRCm39) N226K probably damaging Het
Itpr2 T A 6: 146,142,694 (GRCm39) H1675L probably benign Het
Lipo4 G A 19: 33,476,647 (GRCm39) P367L possibly damaging Het
Lzts3 T C 2: 130,476,686 (GRCm39) *587W probably null Het
Mast3 T A 8: 71,233,251 (GRCm39) K300* probably null Het
Mepce G A 5: 137,783,534 (GRCm39) T264I possibly damaging Het
Mif4gd A T 11: 115,500,372 (GRCm39) I62N probably damaging Het
Or14a260 C T 7: 85,984,852 (GRCm39) V251I probably benign Het
Or7e175 T A 9: 20,049,383 (GRCm39) *324K probably null Het
Palm3 A G 8: 84,756,015 (GRCm39) K509R probably benign Het
Pde11a T C 2: 75,859,647 (GRCm39) T821A probably damaging Het
Pik3r5 A G 11: 68,384,087 (GRCm39) probably benign Het
Pkhd1 T C 1: 20,271,092 (GRCm39) T3154A probably benign Het
Ptprs A G 17: 56,732,534 (GRCm39) Y438H probably damaging Het
Rdh8 T A 9: 20,734,025 (GRCm39) D70E probably benign Het
Scn2a A T 2: 65,544,111 (GRCm39) I831L possibly damaging Het
Selenoo A G 15: 88,980,921 (GRCm39) H420R probably benign Het
Slc22a16 T C 10: 40,446,677 (GRCm39) probably benign Het
Slc5a1 A G 5: 33,302,632 (GRCm39) T208A probably benign Het
Sparc T C 11: 55,296,062 (GRCm39) M121V probably benign Het
Sstr1 G T 12: 58,260,417 (GRCm39) A347S probably benign Het
Stab1 C A 14: 30,879,402 (GRCm39) V693F probably benign Het
Tnn A G 1: 159,972,681 (GRCm39) V307A probably benign Het
Trmt1 A G 8: 85,417,382 (GRCm39) probably benign Het
Ttc3 T C 16: 94,243,760 (GRCm39) S1255P probably benign Het
Ube2ql1 A C 13: 69,887,276 (GRCm39) S62A unknown Het
Vmn2r84 T A 10: 130,221,809 (GRCm39) M804L probably damaging Het
Vps13a T C 19: 16,617,403 (GRCm39) T3002A probably damaging Het
Vps50 A G 6: 3,562,306 (GRCm39) E467G probably damaging Het
Other mutations in Dchs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Dchs1 APN 7 105,407,950 (GRCm39) missense probably damaging 1.00
IGL00422:Dchs1 APN 7 105,407,236 (GRCm39) missense possibly damaging 0.88
IGL00427:Dchs1 APN 7 105,407,631 (GRCm39) missense probably damaging 0.98
IGL00469:Dchs1 APN 7 105,404,468 (GRCm39) missense probably damaging 1.00
IGL00470:Dchs1 APN 7 105,407,414 (GRCm39) missense probably damaging 1.00
IGL00534:Dchs1 APN 7 105,407,150 (GRCm39) missense probably benign
IGL01292:Dchs1 APN 7 105,410,098 (GRCm39) missense probably damaging 0.98
IGL01380:Dchs1 APN 7 105,411,418 (GRCm39) missense probably damaging 1.00
IGL01396:Dchs1 APN 7 105,421,490 (GRCm39) missense probably damaging 1.00
IGL01448:Dchs1 APN 7 105,421,134 (GRCm39) missense probably damaging 0.98
IGL01759:Dchs1 APN 7 105,404,509 (GRCm39) missense probably benign 0.00
IGL01829:Dchs1 APN 7 105,404,604 (GRCm39) missense probably damaging 0.99
IGL01946:Dchs1 APN 7 105,408,312 (GRCm39) missense probably damaging 1.00
IGL01955:Dchs1 APN 7 105,406,798 (GRCm39) missense probably benign 0.00
IGL02012:Dchs1 APN 7 105,413,504 (GRCm39) missense probably damaging 0.98
IGL02222:Dchs1 APN 7 105,414,094 (GRCm39) missense probably damaging 1.00
IGL02261:Dchs1 APN 7 105,421,776 (GRCm39) missense probably damaging 1.00
IGL02365:Dchs1 APN 7 105,404,395 (GRCm39) missense probably benign 0.22
IGL02430:Dchs1 APN 7 105,421,178 (GRCm39) missense probably benign 0.34
IGL02500:Dchs1 APN 7 105,405,013 (GRCm39) missense probably benign
IGL02741:Dchs1 APN 7 105,406,530 (GRCm39) missense probably damaging 1.00
IGL02890:Dchs1 APN 7 105,405,698 (GRCm39) missense probably damaging 1.00
IGL03213:Dchs1 APN 7 105,404,279 (GRCm39) missense probably damaging 1.00
G1patch:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
P0026:Dchs1 UTSW 7 105,407,612 (GRCm39) missense probably damaging 0.99
PIT4377001:Dchs1 UTSW 7 105,406,795 (GRCm39) missense probably damaging 1.00
PIT4791001:Dchs1 UTSW 7 105,408,178 (GRCm39) missense probably damaging 1.00
R0013:Dchs1 UTSW 7 105,405,043 (GRCm39) missense possibly damaging 0.90
R0090:Dchs1 UTSW 7 105,405,139 (GRCm39) missense probably benign 0.18
R0091:Dchs1 UTSW 7 105,415,301 (GRCm39) splice site probably benign
R0193:Dchs1 UTSW 7 105,414,190 (GRCm39) missense probably benign 0.40
R0395:Dchs1 UTSW 7 105,407,745 (GRCm39) missense probably damaging 1.00
R0448:Dchs1 UTSW 7 105,415,134 (GRCm39) missense probably benign 0.00
R0480:Dchs1 UTSW 7 105,420,696 (GRCm39) missense probably benign 0.14
R0485:Dchs1 UTSW 7 105,421,934 (GRCm39) missense probably benign 0.00
R0566:Dchs1 UTSW 7 105,408,402 (GRCm39) missense probably benign 0.00
R0571:Dchs1 UTSW 7 105,421,203 (GRCm39) missense probably damaging 1.00
R0573:Dchs1 UTSW 7 105,407,985 (GRCm39) missense probably damaging 0.98
R0577:Dchs1 UTSW 7 105,413,462 (GRCm39) missense possibly damaging 0.78
R0622:Dchs1 UTSW 7 105,412,656 (GRCm39) missense probably damaging 1.00
R0654:Dchs1 UTSW 7 105,421,556 (GRCm39) missense probably damaging 1.00
R0677:Dchs1 UTSW 7 105,414,191 (GRCm39) missense probably damaging 1.00
R1171:Dchs1 UTSW 7 105,406,921 (GRCm39) missense probably benign
R1241:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R1389:Dchs1 UTSW 7 105,404,778 (GRCm39) missense probably benign 0.40
R1427:Dchs1 UTSW 7 105,415,398 (GRCm39) missense probably benign 0.06
R1458:Dchs1 UTSW 7 105,404,451 (GRCm39) missense probably damaging 1.00
R1513:Dchs1 UTSW 7 105,421,278 (GRCm39) nonsense probably null
R1524:Dchs1 UTSW 7 105,413,732 (GRCm39) missense probably damaging 1.00
R1525:Dchs1 UTSW 7 105,408,138 (GRCm39) missense probably damaging 1.00
R1534:Dchs1 UTSW 7 105,421,247 (GRCm39) missense probably damaging 0.98
R1567:Dchs1 UTSW 7 105,421,068 (GRCm39) missense probably benign 0.01
R1577:Dchs1 UTSW 7 105,415,162 (GRCm39) missense probably damaging 1.00
R1603:Dchs1 UTSW 7 105,411,977 (GRCm39) missense probably benign 0.24
R1676:Dchs1 UTSW 7 105,404,128 (GRCm39) missense probably benign 0.40
R1794:Dchs1 UTSW 7 105,420,927 (GRCm39) missense probably benign 0.02
R1826:Dchs1 UTSW 7 105,406,834 (GRCm39) missense probably damaging 1.00
R1892:Dchs1 UTSW 7 105,413,363 (GRCm39) missense probably benign 0.00
R1924:Dchs1 UTSW 7 105,421,487 (GRCm39) missense possibly damaging 0.81
R1932:Dchs1 UTSW 7 105,415,109 (GRCm39) missense probably damaging 1.00
R1962:Dchs1 UTSW 7 105,413,408 (GRCm39) missense probably damaging 1.00
R1985:Dchs1 UTSW 7 105,421,605 (GRCm39) missense possibly damaging 0.72
R1993:Dchs1 UTSW 7 105,411,755 (GRCm39) missense probably benign 0.00
R2007:Dchs1 UTSW 7 105,404,532 (GRCm39) missense probably damaging 1.00
R2316:Dchs1 UTSW 7 105,413,411 (GRCm39) missense possibly damaging 0.71
R2351:Dchs1 UTSW 7 105,403,301 (GRCm39) missense probably benign
R2474:Dchs1 UTSW 7 105,404,281 (GRCm39) missense probably benign 0.37
R2474:Dchs1 UTSW 7 105,422,045 (GRCm39) missense probably damaging 1.00
R3429:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3430:Dchs1 UTSW 7 105,405,711 (GRCm39) missense possibly damaging 0.85
R3737:Dchs1 UTSW 7 105,411,523 (GRCm39) missense possibly damaging 0.88
R3767:Dchs1 UTSW 7 105,406,292 (GRCm39) missense possibly damaging 0.67
R3874:Dchs1 UTSW 7 105,410,842 (GRCm39) missense probably damaging 1.00
R3883:Dchs1 UTSW 7 105,411,770 (GRCm39) missense probably damaging 1.00
R4105:Dchs1 UTSW 7 105,414,347 (GRCm39) missense probably damaging 1.00
R4209:Dchs1 UTSW 7 105,415,397 (GRCm39) missense probably damaging 0.99
R4329:Dchs1 UTSW 7 105,402,966 (GRCm39) missense probably damaging 1.00
R4516:Dchs1 UTSW 7 105,404,059 (GRCm39) missense probably damaging 1.00
R4579:Dchs1 UTSW 7 105,408,180 (GRCm39) missense probably benign
R4579:Dchs1 UTSW 7 105,403,972 (GRCm39) missense probably damaging 1.00
R4613:Dchs1 UTSW 7 105,421,931 (GRCm39) missense probably damaging 1.00
R4632:Dchs1 UTSW 7 105,403,562 (GRCm39) missense probably benign 0.02
R4696:Dchs1 UTSW 7 105,413,834 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,414,759 (GRCm39) missense probably damaging 1.00
R4725:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4738:Dchs1 UTSW 7 105,407,880 (GRCm39) missense probably damaging 0.96
R4768:Dchs1 UTSW 7 105,420,827 (GRCm39) missense possibly damaging 0.96
R4784:Dchs1 UTSW 7 105,415,133 (GRCm39) missense probably damaging 1.00
R4864:Dchs1 UTSW 7 105,404,460 (GRCm39) missense probably damaging 0.98
R4880:Dchs1 UTSW 7 105,404,937 (GRCm39) missense probably benign 0.00
R4909:Dchs1 UTSW 7 105,415,462 (GRCm39) missense probably damaging 1.00
R5102:Dchs1 UTSW 7 105,421,384 (GRCm39) missense probably benign 0.09
R5109:Dchs1 UTSW 7 105,414,221 (GRCm39) missense probably benign
R5126:Dchs1 UTSW 7 105,402,724 (GRCm39) missense probably damaging 1.00
R5149:Dchs1 UTSW 7 105,404,865 (GRCm39) missense probably damaging 0.98
R5330:Dchs1 UTSW 7 105,403,809 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,421,262 (GRCm39) missense probably damaging 1.00
R5384:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5386:Dchs1 UTSW 7 105,407,236 (GRCm39) missense probably damaging 1.00
R5622:Dchs1 UTSW 7 105,404,500 (GRCm39) missense probably benign 0.11
R5623:Dchs1 UTSW 7 105,421,976 (GRCm39) missense probably damaging 1.00
R5708:Dchs1 UTSW 7 105,422,016 (GRCm39) missense probably damaging 1.00
R5718:Dchs1 UTSW 7 105,404,955 (GRCm39) missense probably benign 0.01
R5743:Dchs1 UTSW 7 105,420,803 (GRCm39) missense probably benign
R5759:Dchs1 UTSW 7 105,413,383 (GRCm39) missense probably damaging 0.99
R5772:Dchs1 UTSW 7 105,422,247 (GRCm39) missense probably damaging 1.00
R5860:Dchs1 UTSW 7 105,421,242 (GRCm39) missense probably damaging 1.00
R5916:Dchs1 UTSW 7 105,408,373 (GRCm39) missense probably damaging 1.00
R5965:Dchs1 UTSW 7 105,405,132 (GRCm39) missense probably damaging 1.00
R5997:Dchs1 UTSW 7 105,403,302 (GRCm39) missense probably benign 0.08
R6065:Dchs1 UTSW 7 105,404,628 (GRCm39) missense probably damaging 1.00
R6136:Dchs1 UTSW 7 105,410,132 (GRCm39) missense probably benign
R6137:Dchs1 UTSW 7 105,414,313 (GRCm39) missense probably damaging 0.99
R6324:Dchs1 UTSW 7 105,414,145 (GRCm39) missense probably benign 0.05
R6363:Dchs1 UTSW 7 105,407,679 (GRCm39) missense probably benign 0.12
R6466:Dchs1 UTSW 7 105,413,748 (GRCm39) missense probably benign 0.09
R6544:Dchs1 UTSW 7 105,407,385 (GRCm39) missense probably damaging 1.00
R6572:Dchs1 UTSW 7 105,408,013 (GRCm39) missense possibly damaging 0.94
R6579:Dchs1 UTSW 7 105,412,120 (GRCm39) missense probably benign 0.17
R6632:Dchs1 UTSW 7 105,411,085 (GRCm39) missense probably damaging 1.00
R6725:Dchs1 UTSW 7 105,408,000 (GRCm39) missense probably damaging 0.99
R6789:Dchs1 UTSW 7 105,406,210 (GRCm39) missense possibly damaging 0.61
R6868:Dchs1 UTSW 7 105,412,710 (GRCm39) missense possibly damaging 0.91
R7058:Dchs1 UTSW 7 105,406,228 (GRCm39) missense probably benign
R7064:Dchs1 UTSW 7 105,412,392 (GRCm39) missense probably damaging 0.99
R7076:Dchs1 UTSW 7 105,411,078 (GRCm39) missense probably benign 0.04
R7191:Dchs1 UTSW 7 105,414,646 (GRCm39) missense possibly damaging 0.89
R7298:Dchs1 UTSW 7 105,404,338 (GRCm39) nonsense probably null
R7380:Dchs1 UTSW 7 105,407,835 (GRCm39) missense probably benign 0.35
R7438:Dchs1 UTSW 7 105,404,155 (GRCm39) missense probably benign 0.30
R7496:Dchs1 UTSW 7 105,411,066 (GRCm39) missense probably damaging 1.00
R7534:Dchs1 UTSW 7 105,421,580 (GRCm39) missense probably benign 0.00
R7604:Dchs1 UTSW 7 105,415,189 (GRCm39) missense probably damaging 1.00
R7631:Dchs1 UTSW 7 105,408,445 (GRCm39) missense probably benign
R7821:Dchs1 UTSW 7 105,414,352 (GRCm39) missense probably benign 0.00
R7834:Dchs1 UTSW 7 105,414,774 (GRCm39) missense probably benign 0.39
R7841:Dchs1 UTSW 7 105,412,180 (GRCm39) missense probably benign
R7913:Dchs1 UTSW 7 105,408,435 (GRCm39) missense possibly damaging 0.61
R8041:Dchs1 UTSW 7 105,404,395 (GRCm39) missense probably benign 0.45
R8076:Dchs1 UTSW 7 105,411,189 (GRCm39) missense probably damaging 1.00
R8076:Dchs1 UTSW 7 105,405,128 (GRCm39) missense possibly damaging 0.52
R8087:Dchs1 UTSW 7 105,402,706 (GRCm39) missense probably benign 0.41
R8125:Dchs1 UTSW 7 105,414,089 (GRCm39) missense possibly damaging 0.91
R8223:Dchs1 UTSW 7 105,411,824 (GRCm39) missense possibly damaging 0.81
R8239:Dchs1 UTSW 7 105,414,718 (GRCm39) missense probably benign 0.22
R8476:Dchs1 UTSW 7 105,408,015 (GRCm39) missense probably benign 0.05
R8497:Dchs1 UTSW 7 105,408,168 (GRCm39) missense probably damaging 1.00
R8770:Dchs1 UTSW 7 105,420,945 (GRCm39) missense probably damaging 1.00
R8856:Dchs1 UTSW 7 105,410,064 (GRCm39) missense probably damaging 1.00
R8866:Dchs1 UTSW 7 105,404,597 (GRCm39) missense probably benign 0.00
R8948:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R8950:Dchs1 UTSW 7 105,408,212 (GRCm39) missense probably benign 0.30
R9029:Dchs1 UTSW 7 105,402,919 (GRCm39) missense probably benign 0.13
R9039:Dchs1 UTSW 7 105,405,215 (GRCm39) missense probably benign 0.11
R9081:Dchs1 UTSW 7 105,403,636 (GRCm39) missense probably benign 0.00
R9134:Dchs1 UTSW 7 105,404,910 (GRCm39) missense probably damaging 0.96
R9159:Dchs1 UTSW 7 105,415,126 (GRCm39) missense probably benign
R9162:Dchs1 UTSW 7 105,414,732 (GRCm39) missense probably damaging 1.00
R9169:Dchs1 UTSW 7 105,422,114 (GRCm39) missense probably damaging 1.00
R9262:Dchs1 UTSW 7 105,404,833 (GRCm39) missense probably damaging 1.00
R9292:Dchs1 UTSW 7 105,403,120 (GRCm39) missense probably damaging 1.00
R9325:Dchs1 UTSW 7 105,415,402 (GRCm39) missense possibly damaging 0.51
R9376:Dchs1 UTSW 7 105,414,981 (GRCm39) critical splice donor site probably null
R9392:Dchs1 UTSW 7 105,421,869 (GRCm39) missense probably benign 0.09
R9619:Dchs1 UTSW 7 105,413,662 (GRCm39) missense probably benign 0.07
R9680:Dchs1 UTSW 7 105,411,625 (GRCm39) missense probably damaging 1.00
R9687:Dchs1 UTSW 7 105,407,191 (GRCm39) missense probably damaging 0.99
R9747:Dchs1 UTSW 7 105,412,682 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,406,900 (GRCm39) missense probably damaging 1.00
Z1177:Dchs1 UTSW 7 105,407,758 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGGCAAATCTTCAGACACAG -3'
(R):5'- ATAGTCCCTCGTGACTGTTTAC -3'

Sequencing Primer
(F):5'- TCTTCAGACACAGCAACACGGTAG -3'
(R):5'- CTTTGAATACCTGAGGACACTGCG -3'
Posted On 2015-09-24