Incidental Mutation 'R4645:Sympk'
ID350167
Institutional Source Beutler Lab
Gene Symbol Sympk
Ensembl Gene ENSMUSG00000023118
Gene Namesymplekin
Synonyms
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.968) question?
Stock #R4645 (G1)
Quality Score222
Status Validated
Chromosome7
Chromosomal Location19024377-19054618 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 19043460 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 545 (R545L)
Ref Sequence ENSEMBL: ENSMUSP00000023882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023882] [ENSMUST00000146903]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023882
AA Change: R545L

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000023882
Gene: ENSMUSG00000023118
AA Change: R545L

DomainStartEndE-ValueType
low complexity region 106 118 N/A INTRINSIC
Pfam:DUF3453 119 352 1.1e-63 PFAM
low complexity region 473 485 N/A INTRINSIC
Pfam:Symplekin_C 887 1068 4.3e-78 PFAM
low complexity region 1123 1149 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138440
Predicted Effect probably benign
Transcript: ENSMUST00000146903
SMART Domains Protein: ENSMUSP00000138740
Gene: ENSMUSG00000023118

DomainStartEndE-ValueType
Pfam:DUF3453 117 230 1.1e-35 PFAM
Meta Mutation Damage Score 0.2518 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear protein that functions in the regulation of polyadenylation and promotes gene expression. The protein forms a high-molecular weight complex with components of the polyadenylation machinery. It is thought to serve as a scaffold for recruiting regulatory factors to the polyadenylation complex. It also participates in 3'-end maturation of histone mRNAs, which do not undergo polyadenylation. The protein also localizes to the cytoplasmic plaques of tight junctions in some cell types. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous ofr a transgenic gene disruption exhibit anemia at E15 and hydrops fetalis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Vmn2r74 C T 7: 85,957,109 S343N probably benign Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Sympk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01114:Sympk APN 7 19047573 missense probably benign 0.14
IGL01834:Sympk APN 7 19043435 missense probably benign 0.02
IGL02588:Sympk APN 7 19042625 missense probably benign
IGL02601:Sympk APN 7 19048869 missense probably benign 0.31
IGL02645:Sympk APN 7 19052424 missense probably damaging 0.99
IGL02698:Sympk APN 7 19045634 missense probably benign 0.35
IGL02709:Sympk APN 7 19047538 missense probably benign 0.26
IGL02814:Sympk APN 7 19053273 missense probably damaging 1.00
IGL03198:Sympk APN 7 19044996 missense possibly damaging 0.92
butterfinger UTSW 7 19048453 missense probably damaging 0.98
fifth_avenue UTSW 7 19043460 missense possibly damaging 0.83
IGL02991:Sympk UTSW 7 19030577 missense probably damaging 1.00
R0391:Sympk UTSW 7 19046849 missense probably benign 0.06
R1036:Sympk UTSW 7 19048453 missense probably damaging 0.98
R1872:Sympk UTSW 7 19029145 missense probably benign
R2058:Sympk UTSW 7 19043529 missense probably damaging 1.00
R2103:Sympk UTSW 7 19054116 missense probably benign
R2966:Sympk UTSW 7 19030544 missense probably damaging 1.00
R3110:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3112:Sympk UTSW 7 19034484 missense possibly damaging 0.69
R3703:Sympk UTSW 7 19040561 missense probably damaging 0.99
R3775:Sympk UTSW 7 19035955 missense probably damaging 1.00
R3930:Sympk UTSW 7 19047522 missense possibly damaging 0.90
R4638:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4639:Sympk UTSW 7 19043460 missense possibly damaging 0.83
R4688:Sympk UTSW 7 19054410 missense probably benign
R5050:Sympk UTSW 7 19036042 missense probably benign 0.19
R5051:Sympk UTSW 7 19036042 missense probably benign 0.19
R5052:Sympk UTSW 7 19036042 missense probably benign 0.19
R5092:Sympk UTSW 7 19042659 missense probably benign 0.17
R5211:Sympk UTSW 7 19035889 missense probably benign 0.22
R5591:Sympk UTSW 7 19054039 missense probably damaging 1.00
R5678:Sympk UTSW 7 19049472 critical splice donor site probably null
R5972:Sympk UTSW 7 19046824 missense probably benign
R6387:Sympk UTSW 7 19052498 missense possibly damaging 0.94
R6543:Sympk UTSW 7 19036830 missense probably damaging 1.00
R6984:Sympk UTSW 7 19038043 missense probably benign 0.00
R7141:Sympk UTSW 7 19054092 missense probably benign
R7292:Sympk UTSW 7 19036030 missense probably benign 0.01
R7319:Sympk UTSW 7 19035845 missense probably benign
R7887:Sympk UTSW 7 19034439 missense possibly damaging 0.69
R7970:Sympk UTSW 7 19034439 missense possibly damaging 0.69
RF064:Sympk UTSW 7 19034395 frame shift probably null
X0017:Sympk UTSW 7 19040663 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- TGCAAGCCCTGTTCAGCATC -3'
(R):5'- GCTAAGGGCTAGTACCACAG -3'

Sequencing Primer
(F):5'- GAGACACACTCCATGGCAG -3'
(R):5'- GGGCTAGTACCACAGGAACTTTTC -3'
Posted On2015-10-08