Mutagenetix > Incidental Mutations

Incidental Mutation 'R4645:Klhl6'

350191

Institutional Source

Beutler Lab

Gene Symbol

Klhl6

Ensembl Gene

ENSMUSG00000043008

Gene Name

kelch-like 6

Synonyms

MMRRC Submission

041906-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.081) question?

Stock #

R4645 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

19946496-19983037 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 19947147 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Lysine at position 568 (N568K)

Ref Sequence

ENSEMBL: ENSMUSP00000053023 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000058839]

Predicted Effect

probably damaging
Transcript: ENSMUST00000058839
AA Change: N568K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053023
Gene: ENSMUSG00000043008
AA Change: N568K

Domain	Start	End	E-Value	Type
BTB	70	167	1.43e-25	SMART
BACK	172	274	1.68e-35	SMART
Kelch	376	419	3.05e-1	SMART
Kelch	420	466	6.82e-11	SMART
Kelch	467	514	4.27e-3	SMART
Kelch	515	556	3.06e-4	SMART
Kelch	557	604	3.47e-3	SMART

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.4%
20x: 95.7%

Validation Efficiency

98% (53/54)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kelch-like (KLHL) family of proteins, which is involved in B-lymphocyte antigen receptor signaling and germinal-center B-cell maturation. The encoded protein contains an N-terminal broad-complex, tramtrack and bric a brac (BTB) domain that facilitates protein binding and dimerization, a BTB and C-terminal kelch (BACK) domain, and six C-terminal kelch repeat domains. Naturally occurring mutations in this gene are associated with chronic lymphocytic leukemia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit spleen hypoplasia, defects in mature B-cell subsets with normal pro- and pre-B-cell development, severely impaired antigen-dependent germinal center formation, and reduced memory IgG response. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc10	T	C	17: 46,324,774	E101G	probably damaging	Het
Adgrf5	A	G	17: 43,437,525	E29G	probably damaging	Het
Agfg2	T	A	5: 137,684,592		probably benign	Het
Ap4b1	A	G	3: 103,821,449	S468G	probably benign	Het
AY702103	G	T	17: 50,239,913		noncoding transcript	Het
Ccdc14	T	C	16: 34,721,740	L536S	probably damaging	Het
Ccr9	G	T	9: 123,779,593	M101I	probably benign	Het
Celsr1	A	T	15: 85,916,756	V2496E	probably benign	Het
Celsr2	C	A	3: 108,395,969	G2486V	probably damaging	Het
Cntnap3	A	G	13: 64,778,788		probably null	Het
Erlin1	T	C	19: 44,069,320	Y22C	probably damaging	Het
Fam135b	T	C	15: 71,462,340	T1002A	probably benign	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Glud1	T	C	14: 34,311,106	V70A	probably damaging	Het
Hdlbp	A	G	1: 93,422,120		probably benign	Het
Immt	T	C	6: 71,856,939	L184P	probably damaging	Het
Iqsec1	T	G	6: 90,668,013	K983T	probably damaging	Het
Lbhd1	T	G	19: 8,884,088		probably benign	Het
Lrit2	C	T	14: 37,072,475	R499C	probably benign	Het
Lrp6	T	C	6: 134,484,250	D748G	probably damaging	Het
Lrriq4	A	G	3: 30,650,743	K292E	probably benign	Het
Ly96	G	T	1: 16,691,716	E49*	probably null	Het
Lztr1	C	T	16: 17,524,091		probably benign	Het
Mmp12	A	G	9: 7,347,515	M31V	probably benign	Het
Mok	A	T	12: 110,808,439		probably benign	Het
Mpi	T	C	9: 57,550,757	H54R	probably damaging	Het
Naip5	T	A	13: 100,219,830	E1092D	probably benign	Het
Olfr1188	T	C	2: 88,560,378	I292T	probably damaging	Het
Pomt1	G	T	2: 32,242,876		probably benign	Het
Ptpn20	G	A	14: 33,631,212	V303I	probably benign	Het
Pyroxd1	C	G	6: 142,354,741	S199*	probably null	Het
Shank2	A	G	7: 144,410,422	K799R	possibly damaging	Het
Sim1	A	T	10: 50,983,997	T652S	probably benign	Het
Slc8a2	C	T	7: 16,134,239	T132I	probably damaging	Het
Spaca6	A	T	17: 17,836,045		probably benign	Het
Sympk	G	T	7: 19,043,460	R545L	possibly damaging	Het
Tenm4	G	T	7: 96,895,742	G2322W	probably damaging	Het
Thap1	A	G	8: 26,162,569	T135A	probably damaging	Het
Traf3	T	C	12: 111,261,966	V537A	probably damaging	Het
Ttn	T	C	2: 76,748,336	D24071G	probably damaging	Het
Tysnd1	G	T	10: 61,696,183	V205L	probably benign	Het
Unc79	T	C	12: 103,112,822	S1749P	probably benign	Het
Vmn2r50	T	A	7: 10,037,235	*846C	probably null	Het
Vmn2r74	C	T	7: 85,957,109	S343N	probably benign	Het
Zfyve28	T	G	5: 34,222,443		probably benign	Het
Zmym2	T	C	14: 56,928,307	S696P	probably damaging	Het
Zscan4e	T	C	7: 11,307,075	Y290C	possibly damaging	Het
Zswim2	G	T	2: 83,915,547	H516N	probably benign	Het

Other mutations in Klhl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00788:Klhl6	APN	16	19957062	missense	probably benign	0.00
IGL01465:Klhl6	APN	16	19982822	missense	probably damaging	0.98
IGL01831:Klhl6	APN	16	19953485	missense	probably damaging	1.00
IGL01971:Klhl6	APN	16	19949526	missense	probably damaging	0.99
IGL02532:Klhl6	APN	16	19957082	missense	possibly damaging	0.84
IGL03113:Klhl6	APN	16	19957251	missense	possibly damaging	0.68
IGL03290:Klhl6	APN	16	19947137	missense	probably benign	0.44
Ascension	UTSW	16	19947098	missense	probably damaging	1.00
besmirched	UTSW	16	19949447	splice site	probably null
blau	UTSW	16	19957005	missense	probably damaging	1.00
blossom	UTSW	16	19957139	missense	probably damaging	1.00
cerulean	UTSW	16	19957218	nonsense	probably null
grossbeak	UTSW	16	19949451	missense	probably null	1.00
heights	UTSW	16	19957028	missense	probably damaging	0.98
Lazuli	UTSW	16	19956966	frame shift	probably null
Parula	UTSW	16	19957043	missense	possibly damaging	0.56
torres_del_paine	UTSW	16	19948127	missense	probably damaging	1.00
turquoise	UTSW	16	19982796	missense	probably damaging	1.00
IGL03046:Klhl6	UTSW	16	19982889	missense	probably benign
R0265:Klhl6	UTSW	16	19948234	missense	probably benign	0.43
R0496:Klhl6	UTSW	16	19956966	frame shift	probably null
R0497:Klhl6	UTSW	16	19956966	frame shift	probably null
R0540:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0541:Klhl6	UTSW	16	19949447	splice site	probably null
R0554:Klhl6	UTSW	16	19953593	missense	probably damaging	0.96
R0607:Klhl6	UTSW	16	19957014	missense	possibly damaging	0.95
R0636:Klhl6	UTSW	16	19948073	splice site	probably benign
R0670:Klhl6	UTSW	16	19949559	missense	possibly damaging	0.92
R1477:Klhl6	UTSW	16	19965977	missense	probably benign	0.00
R1510:Klhl6	UTSW	16	19947098	missense	probably damaging	1.00
R1547:Klhl6	UTSW	16	19966082	missense	probably benign
R1747:Klhl6	UTSW	16	19947028	missense	probably benign	0.40
R1871:Klhl6	UTSW	16	19957043	missense	possibly damaging	0.56
R1966:Klhl6	UTSW	16	19982822	missense	probably damaging	0.98
R2058:Klhl6	UTSW	16	19982931	missense	probably benign
R4466:Klhl6	UTSW	16	19957268	missense	probably damaging	0.99
R4690:Klhl6	UTSW	16	19957284	missense	probably benign	0.44
R4824:Klhl6	UTSW	16	19957028	missense	probably damaging	0.98
R4833:Klhl6	UTSW	16	19957139	missense	probably damaging	1.00
R4835:Klhl6	UTSW	16	19957033	missense	probably benign	0.07
R5001:Klhl6	UTSW	16	19946991	makesense	probably null
R5475:Klhl6	UTSW	16	19948127	missense	probably damaging	1.00
R5700:Klhl6	UTSW	16	19957218	nonsense	probably null
R5867:Klhl6	UTSW	16	19982820	missense	probably benign	0.37
R5910:Klhl6	UTSW	16	19957094	missense	probably benign	0.04
R6992:Klhl6	UTSW	16	19953587	missense	probably damaging	1.00
R7082:Klhl6	UTSW	16	19982883	missense	probably benign	0.00
R7262:Klhl6	UTSW	16	19982796	missense	probably damaging	1.00
R7314:Klhl6	UTSW	16	19957005	missense	probably damaging	1.00
R7464:Klhl6	UTSW	16	19957113	missense	possibly damaging	0.58
R7688:Klhl6	UTSW	16	19947131	missense	probably damaging	1.00
R7957:Klhl6	UTSW	16	19949451	missense	probably null	1.00
R8319:Klhl6	UTSW	16	19957190	missense	possibly damaging	0.74
R8460:Klhl6	UTSW	16	19957031	missense	probably damaging	1.00
Z1176:Klhl6	UTSW	16	19953674	missense	probably damaging	1.00
Z1177:Klhl6	UTSW	16	19982961	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- CCTATGGCTCACAAGGAACGAC -3'
(R):5'- AAGATGACCAGCATGCATGTTC -3'

Sequencing Primer
(F):5'- CTAGGGTATAGGTGCTCAGAGACTCC -3'
(R):5'- AGCATGCATGTTCTTTCTTCGCAG -3'

Posted On

2015-10-08