Incidental Mutation 'R4645:Vmn2r74'
ID350168
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Namevomeronasal 2, receptor 74
SynonymsEG546980
MMRRC Submission 041906-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.102) question?
Stock #R4645 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location85951867-85961482 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 85957109 bp
ZygosityHeterozygous
Amino Acid Change Serine to Asparagine at position 343 (S343N)
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
Predicted Effect probably benign
Transcript: ENSMUST00000166355
AA Change: S343N

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: S343N

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.7%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc10 T C 17: 46,324,774 E101G probably damaging Het
Adgrf5 A G 17: 43,437,525 E29G probably damaging Het
Agfg2 T A 5: 137,684,592 probably benign Het
Ap4b1 A G 3: 103,821,449 S468G probably benign Het
AY702103 G T 17: 50,239,913 noncoding transcript Het
Ccdc14 T C 16: 34,721,740 L536S probably damaging Het
Ccr9 G T 9: 123,779,593 M101I probably benign Het
Celsr1 A T 15: 85,916,756 V2496E probably benign Het
Celsr2 C A 3: 108,395,969 G2486V probably damaging Het
Cntnap3 A G 13: 64,778,788 probably null Het
Erlin1 T C 19: 44,069,320 Y22C probably damaging Het
Fam135b T C 15: 71,462,340 T1002A probably benign Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Glud1 T C 14: 34,311,106 V70A probably damaging Het
Hdlbp A G 1: 93,422,120 probably benign Het
Immt T C 6: 71,856,939 L184P probably damaging Het
Iqsec1 T G 6: 90,668,013 K983T probably damaging Het
Klhl6 A T 16: 19,947,147 N568K probably damaging Het
Lbhd1 T G 19: 8,884,088 probably benign Het
Lrit2 C T 14: 37,072,475 R499C probably benign Het
Lrp6 T C 6: 134,484,250 D748G probably damaging Het
Lrriq4 A G 3: 30,650,743 K292E probably benign Het
Ly96 G T 1: 16,691,716 E49* probably null Het
Lztr1 C T 16: 17,524,091 probably benign Het
Mmp12 A G 9: 7,347,515 M31V probably benign Het
Mok A T 12: 110,808,439 probably benign Het
Mpi T C 9: 57,550,757 H54R probably damaging Het
Naip5 T A 13: 100,219,830 E1092D probably benign Het
Olfr1188 T C 2: 88,560,378 I292T probably damaging Het
Pomt1 G T 2: 32,242,876 probably benign Het
Ptpn20 G A 14: 33,631,212 V303I probably benign Het
Pyroxd1 C G 6: 142,354,741 S199* probably null Het
Shank2 A G 7: 144,410,422 K799R possibly damaging Het
Sim1 A T 10: 50,983,997 T652S probably benign Het
Slc8a2 C T 7: 16,134,239 T132I probably damaging Het
Spaca6 A T 17: 17,836,045 probably benign Het
Sympk G T 7: 19,043,460 R545L possibly damaging Het
Tenm4 G T 7: 96,895,742 G2322W probably damaging Het
Thap1 A G 8: 26,162,569 T135A probably damaging Het
Traf3 T C 12: 111,261,966 V537A probably damaging Het
Ttn T C 2: 76,748,336 D24071G probably damaging Het
Tysnd1 G T 10: 61,696,183 V205L probably benign Het
Unc79 T C 12: 103,112,822 S1749P probably benign Het
Vmn2r50 T A 7: 10,037,235 *846C probably null Het
Zfyve28 T G 5: 34,222,443 probably benign Het
Zmym2 T C 14: 56,928,307 S696P probably damaging Het
Zscan4e T C 7: 11,307,075 Y290C possibly damaging Het
Zswim2 G T 2: 83,915,547 H516N probably benign Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85957130 missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85957580 missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85957484 missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85957206 missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85961292 missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85957592 missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85961461 missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85957323 missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85952516 missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85952616 missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85957373 missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85952692 nonsense probably null
IGL03370:Vmn2r74 APN 7 85958057 missense probably benign
R0115:Vmn2r74 UTSW 7 85957356 missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85952283 missense probably benign 0.06
R0415:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R0571:Vmn2r74 UTSW 7 85952421 missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85961309 nonsense probably null
R0659:Vmn2r74 UTSW 7 85955914 splice site probably benign
R1202:Vmn2r74 UTSW 7 85961337 missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85952442 missense probably benign
R2079:Vmn2r74 UTSW 7 85957175 missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85961314 missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85956114 missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85958258 missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85958137 missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85957187 missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85957354 missense probably benign
R4294:Vmn2r74 UTSW 7 85957416 missense probably benign 0.14
R4646:Vmn2r74 UTSW 7 85957574 missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85961347 missense probably benign
R4901:Vmn2r74 UTSW 7 85955991 nonsense probably null
R5532:Vmn2r74 UTSW 7 85951989 missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85957380 missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85957140 missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85958290 missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85952072 missense probably damaging 1.00
R6255:Vmn2r74 UTSW 7 85952451 missense possibly damaging 0.90
R6468:Vmn2r74 UTSW 7 85961391 missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85957550 missense probably damaging 1.00
R6816:Vmn2r74 UTSW 7 85961413 nonsense probably null
R6836:Vmn2r74 UTSW 7 85957422 missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R6995:Vmn2r74 UTSW 7 85957652 critical splice acceptor site probably null
R7186:Vmn2r74 UTSW 7 85951942 nonsense probably null
R7246:Vmn2r74 UTSW 7 85955965 missense probably benign
R7374:Vmn2r74 UTSW 7 85957422 missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85957071 nonsense probably null
R7525:Vmn2r74 UTSW 7 85961302 missense probably benign
R7569:Vmn2r74 UTSW 7 85952336 missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85957538 missense probably benign 0.11
Z1176:Vmn2r74 UTSW 7 85955627 missense probably damaging 1.00
Z31818:Vmn2r74 UTSW 7 85955521 intron probably null
Predicted Primers PCR Primer
(F):5'- TGCAAAAGCATCCCATGGAG -3'
(R):5'- CTATGCCTTCATTGTGTGGAAATC -3'

Sequencing Primer
(F):5'- GGCCACAGCATACATAGCGTTG -3'
(R):5'- CTCAAGACCTTTTCAGAATCTGGG -3'
Posted On2015-10-08