Mutagenetix > Incidental Mutation

Incidental Mutation 'R4668:Cbl'

352169

Institutional Source

Beutler Lab

Gene Symbol

Cbl

Ensembl Gene

ENSMUSG00000034342

Gene Name

Casitas B-lineage lymphoma

Synonyms

Cbl-2, c-Cbl

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.586) question?

Stock #

R4668 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

44142976-44234049 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 44153848 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 728 (C728S)

Ref Sequence

ENSEMBL: ENSMUSP00000146244 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]

AlphaFold

P22682

Predicted Effect

probably benign
Transcript: ENSMUST00000037644
AA Change: C684S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: C684S

Domain	Start	End	E-Value	Type
low complexity region	8	23	N/A	INTRINSIC
low complexity region	34	46	N/A	INTRINSIC
Pfam:Cbl_N	49	173	9.4e-59	PFAM
Pfam:Cbl_N2	177	260	4.7e-44	PFAM
Pfam:Cbl_N3	262	347	7.2e-48	PFAM
RING	379	417	1.04e-7	SMART
low complexity region	454	463	N/A	INTRINSIC
low complexity region	530	549	N/A	INTRINSIC
UBA	864	901	3.17e-8	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000205313

Predicted Effect

probably benign
Transcript: ENSMUST00000205968
AA Change: C711S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000206125

Predicted Effect

probably benign
Transcript: ENSMUST00000206147
AA Change: C728S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

Predicted Effect

unknown
Transcript: ENSMUST00000206258
AA Change: C27S

Predicted Effect

probably benign
Transcript: ENSMUST00000206720
AA Change: C728S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.3%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 105 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4921528I07Rik	A	T	9: 114,304,711		noncoding transcript	Het
6430548M08Rik	T	C	8: 120,160,414		probably null	Het
Abca4	G	A	3: 122,155,299	G531E	possibly damaging	Het
Acad8	A	G	9: 26,990,627	L147P	probably damaging	Het
Acot10	T	C	15: 20,665,942	S238G	probably benign	Het
Adamtsl2	A	T	2: 27,095,475	H457L	probably benign	Het
Ankrd35	A	T	3: 96,679,208	T67S	probably damaging	Het
Aox2	T	G	1: 58,334,694	I838S	possibly damaging	Het
Arnt2	T	C	7: 84,275,386	N411S	probably damaging	Het
Bmpr2	T	C	1: 59,867,716	L656S	probably damaging	Het
Carns1	A	T	19: 4,165,476	Y902*	probably null	Het
Cavin1	T	C	11: 100,958,796	E336G	probably damaging	Het
Ccdc136	C	A	6: 29,411,281	Q218K	probably damaging	Het
Cdk19	C	A	10: 40,466,710	T196K	probably damaging	Het
Ceacam20	T	C	7: 19,986,027	Y495H	probably damaging	Het
Celf2	T	C	2: 6,721,528	I47V	probably benign	Het
Ces3a	A	C	8: 105,053,423	K299T	probably damaging	Het
Cfap61	A	T	2: 146,143,136	I967F	probably damaging	Het
Cnksr1	C	T	4: 134,232,971		probably benign	Het
Cped1	T	C	6: 22,237,653	Y923H	probably benign	Het
Crip3	T	C	17: 46,429,364	L30P	probably damaging	Het
Csmd1	A	G	8: 16,023,891	I2030T	possibly damaging	Het
Ctse	C	A	1: 131,662,749	P70T	probably damaging	Het
Cyp2b23	A	G	7: 26,672,734	F429L	probably damaging	Het
Cyp2c66	T	A	19: 39,176,656	D360E	probably damaging	Het
D8Ertd738e	A	T	8: 84,249,481	L46*	probably null	Het
Dcp2	T	A	18: 44,415,362		probably null	Het
Ddx10	C	A	9: 53,099,213	D834Y	possibly damaging	Het
Ddx19a	A	T	8: 110,979,084	V245E	probably damaging	Het
Dpf2	A	C	19: 5,904,487	D130E	probably benign	Het
Emc8	A	T	8: 120,667,779	M67K	probably damaging	Het
Ephb6	T	C	6: 41,614,602	L231P	possibly damaging	Het
Erp27	T	C	6: 136,908,152	E216G	possibly damaging	Het
Esco1	A	T	18: 10,594,734	I184N	possibly damaging	Het
Fam205c	A	G	4: 42,871,608	F256L	probably benign	Het
Fdxacb1	T	A	9: 50,770,260	D11E	possibly damaging	Het
Fhod3	C	T	18: 25,066,338	P689S	probably benign	Het
Fnip1	T	A	11: 54,503,559	S940R	probably damaging	Het
Ganc	G	T	2: 120,431,067	V343F	probably benign	Het
Gldn	T	A	9: 54,332,018	L228*	probably null	Het
Gm1123	C	T	9: 99,009,373	R341H	probably damaging	Het
Gtf2f2	T	C	14: 75,917,638	Y161C	probably benign	Het
Gtf3c1	T	C	7: 125,667,338	T979A	probably damaging	Het
Hist1h4a	A	G	13: 23,760,976	V61A	probably benign	Het
Hmcn2	G	T	2: 31,435,792	R4277L	probably benign	Het
Hsd17b6	T	A	10: 127,994,426		probably null	Het
Igkv12-46	T	C	6: 69,764,797	T25A	probably damaging	Het
Inpp5e	G	A	2: 26,400,994	R354C	probably damaging	Het
Jcad	T	A	18: 4,680,221		probably null	Het
Kcna10	G	T	3: 107,194,694	A214S	possibly damaging	Het
Kit	T	C	5: 75,641,220		probably null	Het
Kmt2a	G	A	9: 44,824,572		probably benign	Het
Lama1	T	C	17: 67,752,434	V604A	probably benign	Het
Mesd	T	C	7: 83,895,756	V138A	probably damaging	Het
Mmp13	T	C	9: 7,272,580	F9S	possibly damaging	Het
Mocos	T	C	18: 24,666,434	Y242H	probably benign	Het
Mrc1	A	C	2: 14,293,486	T718P	probably damaging	Het
Msh6	T	C	17: 87,984,806	S330P	possibly damaging	Het
Myh10	A	G	11: 68,804,642	K1532E	probably damaging	Het
Nat9	T	C	11: 115,184,542	N91S	probably damaging	Het
Neto2	A	T	8: 85,641,062	I351N	probably damaging	Het
Nfx1	A	G	4: 40,976,367	N14D	possibly damaging	Het
Nlrp4b	A	G	7: 10,714,733	T288A	possibly damaging	Het
Nutm2	C	A	13: 50,472,997	T396K	probably benign	Het
Ogdhl	A	G	14: 32,332,536	T196A	probably benign	Het
Olfr1453	A	T	19: 13,028,081	F83I	probably benign	Het
Olfr548-ps1	A	G	7: 102,542,604	I223V	possibly damaging	Het
Olfr582	A	T	7: 103,041,851	D119V	probably benign	Het
Omg	T	A	11: 79,502,423	N203I	probably damaging	Het
Pdgfrb	A	G	18: 61,064,113	Y207C	probably damaging	Het
Pdzd7	T	A	19: 45,045,687		probably benign	Het
Pgs1	C	A	11: 118,003,507	H157N	probably damaging	Het
Pik3c2a	A	G	7: 116,358,688	V1121A	probably benign	Het
Pikfyve	T	A	1: 65,250,273	C1235S	probably damaging	Het
Pms1	G	A	1: 53,189,474	Q872*	probably null	Het
Ptgs2	A	G	1: 150,101,084	T23A	probably benign	Het
Rgl1	T	G	1: 152,521,371	R716S	probably damaging	Het
Rif1	A	G	2: 52,111,952	E1806G	probably benign	Het
Ripor1	T	C	8: 105,614,652	V39A	probably benign	Het
Ryr2	G	T	13: 11,593,117	T868N	probably benign	Het
Sec22b	A	T	3: 97,921,122	D167V	probably damaging	Het
Sec24d	T	C	3: 123,355,774	V810A	probably damaging	Het
Shh	T	C	5: 28,457,855	*438W	probably null	Het
Slc25a12	G	A	2: 71,315,062	S178L	probably benign	Het
Sorl1	A	T	9: 41,984,508	W1784R	probably damaging	Het
Sp3	A	T	2: 72,970,981	S229R	probably damaging	Het
Spdye4c	G	A	2: 128,592,353	V5I	possibly damaging	Het
Spint2	A	T	7: 29,260,379	V53D	probably damaging	Het
Stard3nl	T	A	13: 19,376,519	N29Y	probably damaging	Het
Stk25	A	G	1: 93,625,483	S299P	probably damaging	Het
Sult2a3	A	G	7: 14,122,861	S45P	probably damaging	Het
Thsd7a	A	T	6: 12,408,968	V685E	probably damaging	Het
Tm9sf4	T	A	2: 153,187,308	V92D	probably damaging	Het
Top2b	T	G	14: 16,409,189	I777M	probably damaging	Het
Topors	G	A	4: 40,262,669	T205I	probably damaging	Het
Tpo	T	A	12: 30,103,290	Y355F	probably benign	Het
Uba1y	T	A	Y: 826,032	M396K	possibly damaging	Het
Vmn1r50	A	T	6: 90,107,531	Q86L	probably benign	Het
Vmn1r77	A	G	7: 12,041,431	K45E	probably damaging	Het
Vmn2r114	A	C	17: 23,310,473	N218K	possibly damaging	Het
Vmn2r66	T	A	7: 84,994,697	N835I	probably damaging	Het
Vps54	T	G	11: 21,299,989	N458K	probably benign	Het
Zcchc7	G	T	4: 44,895,964	C304F	probably damaging	Het
Zfp335	A	T	2: 164,900,286	C593S	probably damaging	Het
Zmynd15	C	G	11: 70,462,588	P214R	probably damaging	Het

Other mutations in Cbl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00590:Cbl	APN	9	44201198	missense	probably damaging	1.00
IGL01369:Cbl	APN	9	44201061	nonsense	probably null
IGL01434:Cbl	APN	9	44164206	missense	probably damaging	0.99
IGL01866:Cbl	APN	9	44153825	nonsense	probably null
IGL02326:Cbl	APN	9	44151473	missense	possibly damaging	0.94
IGL02956:Cbl	APN	9	44169034	missense	probably damaging	1.00
Bungalow	UTSW	9	44201119	missense	probably damaging	1.00
Casita	UTSW	9	44164165	missense	probably damaging	1.00
tiny_house	UTSW	9	44164152	missense	probably damaging	1.00
R0068:Cbl	UTSW	9	44154194	missense	probably damaging	0.98
R0390:Cbl	UTSW	9	44201005	missense	probably damaging	1.00
R0655:Cbl	UTSW	9	44158752	missense	probably damaging	1.00
R0764:Cbl	UTSW	9	44164152	missense	probably damaging	1.00
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1466:Cbl	UTSW	9	44154244	missense	probably benign	0.10
R1616:Cbl	UTSW	9	44152900	missense	probably damaging	0.99
R1736:Cbl	UTSW	9	44152895	missense	possibly damaging	0.80
R1808:Cbl	UTSW	9	44164229	missense	probably damaging	1.00
R1865:Cbl	UTSW	9	44164165	missense	probably damaging	1.00
R3156:Cbl	UTSW	9	44158850	missense	possibly damaging	0.74
R3431:Cbl	UTSW	9	44151446	makesense	probably null
R4700:Cbl	UTSW	9	44173380	missense	probably damaging	1.00
R4866:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4900:Cbl	UTSW	9	44152869	missense	probably benign	0.00
R4995:Cbl	UTSW	9	44153811	missense	possibly damaging	0.62
R5014:Cbl	UTSW	9	44154399	splice site	probably null
R5324:Cbl	UTSW	9	44154254	missense	probably damaging	0.97
R5353:Cbl	UTSW	9	44173323	missense	probably damaging	1.00
R5382:Cbl	UTSW	9	44159021	missense	probably benign
R5747:Cbl	UTSW	9	44201119	missense	probably damaging	1.00
R5834:Cbl	UTSW	9	44233779	missense	probably damaging	1.00
R6307:Cbl	UTSW	9	44158512	critical splice donor site	probably null
R6755:Cbl	UTSW	9	44173374	missense	probably damaging	0.98
R7393:Cbl	UTSW	9	44154188	critical splice donor site	probably null
R7779:Cbl	UTSW	9	44159096	missense	probably benign
R7789:Cbl	UTSW	9	44163467	missense	probably damaging	1.00
R8094:Cbl	UTSW	9	44163399	missense	probably benign	0.03
R8104:Cbl	UTSW	9	44158539	missense	possibly damaging	0.93
R8146:Cbl	UTSW	9	44164874	missense	probably damaging	1.00
R8340:Cbl	UTSW	9	44159000	missense	possibly damaging	0.77
R8424:Cbl	UTSW	9	44152854	missense	possibly damaging	0.51
R8920:Cbl	UTSW	9	44167273	missense	probably damaging	0.99
R9185:Cbl	UTSW	9	44152840	missense	probably damaging	1.00
X0057:Cbl	UTSW	9	44233767	small deletion	probably benign

Predicted Primers

PCR Primer
(F):5'- TCCTCGGTTTAAGCTATATCAACC -3'
(R):5'- CAGGCCTCTAGAACATGCAC -3'

Sequencing Primer
(F):5'- ATTTGCTATGCAGGCCAAGC -3'
(R):5'- GCACATCTGATCTTGTCATGAGTCAG -3'

Posted On

2015-10-08