Incidental Mutation 'R4713:Tbx10'
ID353407
Institutional Source Beutler Lab
Gene Symbol Tbx10
Ensembl Gene ENSMUSG00000037477
Gene NameT-box 10
SynonymsTbx13, Tbx7
MMRRC Submission 041601-MU
Accession Numbers

Ncbi RefSeq: NM_001001320.1, NM_011533.2; MGI:1261436

Is this an essential gene? Probably non essential (E-score: 0.222) question?
Stock #R4713 (G1)
Quality Score167
Status Not validated
Chromosome19
Chromosomal Location3992752-3999511 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3996921 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 108 (L108P)
Ref Sequence ENSEMBL: ENSMUSP00000037401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025802] [ENSMUST00000041871] [ENSMUST00000122924] [ENSMUST00000155405]
Predicted Effect probably benign
Transcript: ENSMUST00000025802
SMART Domains Protein: ENSMUSP00000025802
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 26 160 2.8e-14 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000041871
AA Change: L108P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000037401
Gene: ENSMUSG00000037477
AA Change: L108P

DomainStartEndE-ValueType
TBOX 64 257 9.2e-117 SMART
low complexity region 309 320 N/A INTRINSIC
low complexity region 331 351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122924
SMART Domains Protein: ENSMUSP00000122531
Gene: ENSMUSG00000110949

DomainStartEndE-ValueType
Pfam:NUDIX 19 117 3.1e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155405
SMART Domains Protein: ENSMUSP00000119218
Gene: ENSMUSG00000024869

DomainStartEndE-ValueType
Pfam:NUDIX 29 159 8.1e-15 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156285
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 94.0%
Validation Efficiency
MGI Phenotype Strain: 1861236
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the T-box family of transcription factors. These transcription factors share a DNA-binding domain called the T-box, and play a role in several developmental processes including early embryonic cell fate and organogenesis. The encoded protein is a member of the T-box 1 subfamily. Mutations in this gene are thought to be a cause of isolated cleft lip with or without cleft palate. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a gain of function mutation die perinatally with cleft lip and cleft palate; heterozygotes show penetrance and strain effects - they generally circle and head-toss, but are not deaf, lack the macula of utriculus and show defects of the labyrinths in the vestibular region. [provided by MGI curators]
Allele List at MGI

All alleles(6) : Targeted(5) Spontaneous(1)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrb3 G T 1: 25,547,532 T360K probably damaging Het
AW551984 T C 9: 39,597,153 K356E probably benign Het
Bpifb2 T A 2: 153,881,193 V123E probably damaging Het
Cacna1a T G 8: 84,549,514 F532V probably damaging Het
Cct8 C A 16: 87,487,688 E204* probably null Het
Cd163 T A 6: 124,317,618 probably null Het
Cep152 C A 2: 125,587,948 A685S possibly damaging Het
Chdh A G 14: 30,036,841 D581G probably benign Het
Cnpy3 A C 17: 46,747,465 Y77* probably null Het
Col5a3 T C 9: 20,793,574 E762G unknown Het
Creb3 A G 4: 43,563,247 T115A probably benign Het
Dlat G T 9: 50,644,481 A412E probably benign Het
Dnah2 T C 11: 69,476,688 N1789S probably damaging Het
Dzank1 C T 2: 144,491,804 E370K probably benign Het
Eif3m A T 2: 105,006,839 probably null Het
Gimap8 A T 6: 48,658,986 M562L probably benign Het
Gm15448 G T 7: 3,822,681 Y396* probably null Het
Gprc6a T A 10: 51,631,457 probably benign Het
Gsr T G 8: 33,680,319 probably null Het
Gstcd A G 3: 132,983,099 V630A probably damaging Het
Hip1r T C 5: 123,989,980 I116T probably benign Het
Hivep3 A G 4: 120,131,803 E1817G probably damaging Het
Inpp5f A C 7: 128,663,725 T135P probably damaging Het
Ism2 A G 12: 87,285,027 silent Het
Itga11 A G 9: 62,765,788 D784G probably damaging Het
Itpr2 A G 6: 146,373,173 F837S probably damaging Het
Itpr2 T C 6: 146,396,958 E10G probably damaging Het
Knl1 A T 2: 119,069,137 K440* probably null Het
Lonp2 T C 8: 86,713,315 S648P probably damaging Het
Lrba T C 3: 86,359,868 S1622P probably benign Het
Lrp2 G T 2: 69,487,966 A2047D probably damaging Het
Mcm3 G A 1: 20,803,577 T773I probably benign Het
Mfsd7a T C 5: 108,442,079 T486A probably damaging Het
Mki67 A G 7: 135,695,469 V2612A probably benign Het
Mnx1 C A 5: 29,478,131 G49W probably damaging Het
Muc5b T A 7: 141,849,079 Y673* probably null Het
Myo15 A G 11: 60,479,930 H1172R probably benign Het
Myo1g T C 11: 6,516,080 K363R probably null Het
Ncoa4 T A 14: 32,176,641 C473S probably benign Het
Nefh T C 11: 4,939,656 T988A unknown Het
Nwd2 T A 5: 63,804,460 D462E probably benign Het
Olfr332 T C 11: 58,490,087 T223A probably benign Het
Plec T C 15: 76,181,067 E1466G unknown Het
Prl3d2 G T 13: 27,122,396 M35I probably benign Het
Reln T A 5: 22,152,463 I202F probably benign Het
Rhot1 T A 11: 80,225,602 D78E probably benign Het
Rsph3b T C 17: 6,905,129 probably null Het
Scn10a C T 9: 119,609,651 M1717I probably damaging Het
Sema6a T A 18: 47,249,296 H728L possibly damaging Het
Slc26a3 G T 12: 31,457,080 A345S possibly damaging Het
Slc35d2 A G 13: 64,099,283 V261A possibly damaging Het
Ssmem1 A G 6: 30,519,514 D66G probably damaging Het
Sult2a8 A T 7: 14,425,477 N72K probably benign Het
Tex14 T C 11: 87,536,865 S48P probably damaging Het
Tmie A G 9: 110,867,528 L95P probably damaging Het
Tom1l2 C G 11: 60,270,433 R84P probably damaging Het
Trpm3 T A 19: 22,889,435 D543E possibly damaging Het
Vipr2 A C 12: 116,080,131 R49S probably benign Het
Vps8 A T 16: 21,442,439 S110C probably damaging Het
Zfp791 T A 8: 85,110,968 N89I probably damaging Het
Other mutations in Tbx10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01527:Tbx10 APN 19 3998227 missense probably damaging 1.00
IGL01597:Tbx10 APN 19 3996736 missense probably benign 0.00
IGL02006:Tbx10 APN 19 3998186 missense probably damaging 1.00
IGL03294:Tbx10 APN 19 3998571 unclassified probably benign
R0051:Tbx10 UTSW 19 3996798 critical splice donor site probably null
R0105:Tbx10 UTSW 19 3993121 unclassified probably benign
R0626:Tbx10 UTSW 19 3997873 missense probably benign 0.42
R1265:Tbx10 UTSW 19 3996625 missense probably damaging 0.97
R6337:Tbx10 UTSW 19 3997312 nonsense probably null
R7021:Tbx10 UTSW 19 3998961 missense probably benign
R7476:Tbx10 UTSW 19 3999034 missense probably benign 0.00
R7549:Tbx10 UTSW 19 3996651 missense probably benign 0.02
R8768:Tbx10 UTSW 19 3997303 missense probably damaging 1.00
Z1177:Tbx10 UTSW 19 3998186 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGGAAGAGTTCAACCAGCTG -3'
(R):5'- CACCTGGTGGGCATCATTTG -3'

Sequencing Primer
(F):5'- TGGGCACAGAGATGATTGTCACC -3'
(R):5'- GCCTCAGGCTAGCCCATTC -3'
Posted On2015-10-21