Incidental Mutation 'R0276:Slc28a2b'
ID 35354
Institutional Source Beutler Lab
Gene Symbol Slc28a2b
Ensembl Gene ENSMUSG00000079071
Gene Name solute carrier family 28 member 2b
Synonyms Gm14085
MMRRC Submission 038498-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R0276 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 122315422-122358521 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 122352409 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Threonine at position 389 (S389T)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
AlphaFold A2AWR5
Predicted Effect probably damaging
Transcript: ENSMUST00000110521
AA Change: S389T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: S389T

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Meta Mutation Damage Score 0.2251 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
Allele List at MGI
Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts13 A G 2: 26,865,772 (GRCm39) N109S possibly damaging Het
Adcy10 T A 1: 165,400,160 (GRCm39) M1523K possibly damaging Het
Agtpbp1 C T 13: 59,609,845 (GRCm39) S1095N possibly damaging Het
Ang2 C T 14: 51,432,975 (GRCm39) V136I probably damaging Het
Arhgap10 A T 8: 78,140,210 (GRCm39) M250K probably benign Het
Arhgap33 A T 7: 30,222,669 (GRCm39) W1088R probably benign Het
Arhgef15 T C 11: 68,844,298 (GRCm39) probably benign Het
Aspm T C 1: 139,406,209 (GRCm39) S1699P possibly damaging Het
Atp12a C A 14: 56,625,151 (GRCm39) D1014E probably damaging Het
Atp1a4 T A 1: 172,085,468 (GRCm39) K45M probably damaging Het
Atp8a1 A T 5: 67,944,016 (GRCm39) probably benign Het
Baiap3 A C 17: 25,462,661 (GRCm39) F1099C probably damaging Het
Bcas3 T A 11: 85,361,663 (GRCm39) probably null Het
Bms1 G A 6: 118,385,095 (GRCm39) T371M possibly damaging Het
Camta1 C A 4: 151,159,597 (GRCm39) R1614L probably damaging Het
Capn3 T C 2: 120,318,546 (GRCm39) probably benign Het
Ccdc180 A G 4: 45,923,534 (GRCm39) D1105G probably damaging Het
Ccdc33 G T 9: 57,965,675 (GRCm39) P364Q probably damaging Het
Clstn3 A G 6: 124,408,699 (GRCm39) probably benign Het
Cntrl A T 2: 35,041,744 (GRCm39) Y619F possibly damaging Het
Col12a1 A T 9: 79,538,023 (GRCm39) Y2514* probably null Het
Cpt1b T C 15: 89,304,162 (GRCm39) H503R probably benign Het
Crb1 T A 1: 139,251,073 (GRCm39) T293S possibly damaging Het
D130043K22Rik C T 13: 25,042,028 (GRCm39) T319I possibly damaging Het
Dnaaf10 T C 11: 17,179,821 (GRCm39) I274T probably benign Het
Dzip1l G A 9: 99,543,051 (GRCm39) R502Q probably benign Het
Efcab5 A G 11: 77,020,702 (GRCm39) M673T probably damaging Het
Efcab5 G A 11: 77,031,749 (GRCm39) R42W probably damaging Het
F2rl3 A G 8: 73,489,426 (GRCm39) T218A probably benign Het
Fam135a C T 1: 24,107,045 (GRCm39) R31H probably damaging Het
Fcer2a A T 8: 3,739,811 (GRCm39) N53K possibly damaging Het
Golgb1 A C 16: 36,734,238 (GRCm39) K1162Q probably damaging Het
Gpr137b A T 13: 13,542,160 (GRCm39) probably benign Het
Haspin A T 11: 73,027,313 (GRCm39) L592Q probably damaging Het
Helq A G 5: 100,938,013 (GRCm39) F478L probably damaging Het
Iho1 A T 9: 108,305,639 (GRCm39) M11K possibly damaging Het
Il17rb T A 14: 29,726,337 (GRCm39) T84S probably damaging Het
Itga4 T C 2: 79,151,837 (GRCm39) L880P probably damaging Het
Itih5 A G 2: 10,190,375 (GRCm39) I61V possibly damaging Het
Ivl G A 3: 92,478,821 (GRCm39) L415F unknown Het
Kif2a A G 13: 107,113,158 (GRCm39) probably benign Het
Kmt2d T C 15: 98,748,192 (GRCm39) probably benign Het
Lars2 A G 9: 123,267,186 (GRCm39) probably benign Het
Lilrb4a T C 10: 51,367,677 (GRCm39) V73A probably benign Het
Lratd2 G T 15: 60,695,523 (GRCm39) Y74* probably null Het
Lrrc8a A G 2: 30,146,800 (GRCm39) D538G possibly damaging Het
Lrrk1 G A 7: 65,946,011 (GRCm39) probably benign Het
Mc2r A T 18: 68,541,203 (GRCm39) I30K possibly damaging Het
Mybbp1a C A 11: 72,340,933 (GRCm39) probably null Het
Napg C T 18: 63,120,034 (GRCm39) R149C probably damaging Het
Ncam2 A G 16: 81,314,517 (GRCm39) probably benign Het
Nlk T C 11: 78,462,301 (GRCm39) I509V probably benign Het
Nlrp2 A T 7: 5,331,108 (GRCm39) N429K probably benign Het
Nlrp9b A G 7: 19,762,423 (GRCm39) T247A probably benign Het
Noxo1 A T 17: 24,919,136 (GRCm39) probably null Het
Or1n1b A T 2: 36,780,035 (GRCm39) M275K probably benign Het
Or2ag2b A T 7: 106,417,904 (GRCm39) I205L probably benign Het
Or3a10 A G 11: 73,935,944 (GRCm39) I52T probably damaging Het
Or4c107 T A 2: 88,789,099 (GRCm39) C96* probably null Het
Or4m1 C A 14: 50,557,636 (GRCm39) A219S probably benign Het
Oxr1 T C 15: 41,683,458 (GRCm39) S294P probably damaging Het
Pfpl A G 19: 12,406,601 (GRCm39) Y284C probably damaging Het
Pi16 A T 17: 29,545,917 (GRCm39) T232S probably benign Het
Plcxd2 A T 16: 45,830,070 (GRCm39) N50K probably benign Het
Plekhn1 T A 4: 156,312,703 (GRCm39) N52Y probably damaging Het
Prl2c5 T C 13: 13,357,634 (GRCm39) probably benign Het
Prrc2b G A 2: 32,109,666 (GRCm39) V1080I probably damaging Het
Psg28 A T 7: 18,164,321 (GRCm39) N130K probably benign Het
Psme4 C A 11: 30,761,980 (GRCm39) T440K probably damaging Het
Ptcd2 T C 13: 99,458,104 (GRCm39) K296E probably benign Het
Ptprq T C 10: 107,378,596 (GRCm39) probably null Het
Rab5b A C 10: 128,522,615 (GRCm39) probably null Het
Rft1 T A 14: 30,412,540 (GRCm39) S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,000,336 (GRCm39) probably benign Het
Rsu1 A T 2: 13,174,946 (GRCm39) probably benign Het
Senp6 A G 9: 80,044,029 (GRCm39) M887V probably benign Het
Sgcz T A 8: 38,420,073 (GRCm39) M60L probably benign Het
Siglec1 G A 2: 130,925,861 (GRCm39) Q282* probably null Het
Sipa1l2 T C 8: 126,148,679 (GRCm39) T1655A probably damaging Het
Slc43a3 G A 2: 84,768,007 (GRCm39) probably benign Het
Snx29 T C 16: 11,556,237 (GRCm39) V756A probably benign Het
Spta1 T A 1: 174,045,460 (GRCm39) H1539Q probably damaging Het
Stk3 A C 15: 35,099,615 (GRCm39) S104A probably damaging Het
Stk38 C A 17: 29,211,390 (GRCm39) probably null Het
Stx6 T C 1: 155,049,909 (GRCm39) probably benign Het
Thbs4 G A 13: 92,912,040 (GRCm39) T230I probably benign Het
Thrsp A G 7: 97,066,709 (GRCm39) M1T probably null Het
Tmem63b A T 17: 45,986,299 (GRCm39) probably benign Het
Top2a A G 11: 98,900,733 (GRCm39) probably benign Het
Tpd52l2 T C 2: 181,143,852 (GRCm39) probably null Het
Trak1 A G 9: 121,283,404 (GRCm39) E390G probably damaging Het
Trappc3 T A 4: 126,167,745 (GRCm39) D101E possibly damaging Het
Trhr A G 15: 44,060,482 (GRCm39) M1V probably null Het
Triobp T A 15: 78,857,876 (GRCm39) I1159K probably benign Het
Unc45a A G 7: 79,976,045 (GRCm39) probably benign Het
Usb1 A G 8: 96,060,085 (GRCm39) D12G probably damaging Het
Ushbp1 C T 8: 71,847,293 (GRCm39) C113Y possibly damaging Het
Vim A G 2: 13,579,670 (GRCm39) K143R probably benign Het
Vmn2r75 T C 7: 85,797,515 (GRCm39) K766R probably benign Het
Xpo5 T G 17: 46,552,433 (GRCm39) C1089G probably damaging Het
Other mutations in Slc28a2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Slc28a2b APN 2 122,347,527 (GRCm39) missense probably damaging 0.98
IGL01160:Slc28a2b APN 2 122,355,277 (GRCm39) critical splice acceptor site probably null
IGL01838:Slc28a2b APN 2 122,348,464 (GRCm39) missense possibly damaging 0.65
IGL01895:Slc28a2b APN 2 122,355,572 (GRCm39) missense possibly damaging 0.75
IGL02999:Slc28a2b APN 2 122,344,995 (GRCm39) splice site probably benign
Wilted UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
K2124:Slc28a2b UTSW 2 122,355,634 (GRCm39) missense probably benign 0.00
R0084:Slc28a2b UTSW 2 122,353,314 (GRCm39) missense possibly damaging 0.95
R0092:Slc28a2b UTSW 2 122,348,078 (GRCm39) splice site probably benign
R0127:Slc28a2b UTSW 2 122,347,550 (GRCm39) critical splice donor site probably null
R0200:Slc28a2b UTSW 2 122,357,928 (GRCm39) makesense probably null
R0309:Slc28a2b UTSW 2 122,348,034 (GRCm39) missense probably benign 0.04
R0403:Slc28a2b UTSW 2 122,352,335 (GRCm39) missense probably damaging 1.00
R0600:Slc28a2b UTSW 2 122,344,879 (GRCm39) missense probably damaging 0.97
R0612:Slc28a2b UTSW 2 122,352,179 (GRCm39) missense probably damaging 1.00
R1676:Slc28a2b UTSW 2 122,352,340 (GRCm39) missense probably damaging 0.99
R1801:Slc28a2b UTSW 2 122,352,133 (GRCm39) missense possibly damaging 0.57
R1986:Slc28a2b UTSW 2 122,357,910 (GRCm39) missense probably benign 0.00
R2050:Slc28a2b UTSW 2 122,353,349 (GRCm39) missense probably benign 0.21
R3078:Slc28a2b UTSW 2 122,344,895 (GRCm39) missense possibly damaging 0.63
R4075:Slc28a2b UTSW 2 122,344,892 (GRCm39) missense probably benign 0.00
R4096:Slc28a2b UTSW 2 122,353,209 (GRCm39) missense probably damaging 1.00
R4744:Slc28a2b UTSW 2 122,353,286 (GRCm39) nonsense probably null
R4796:Slc28a2b UTSW 2 122,344,940 (GRCm39) missense probably damaging 0.99
R5033:Slc28a2b UTSW 2 122,353,395 (GRCm39) critical splice donor site probably null
R5069:Slc28a2b UTSW 2 122,324,854 (GRCm39) missense possibly damaging 0.93
R5288:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5385:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5386:Slc28a2b UTSW 2 122,353,259 (GRCm39) missense probably benign 0.01
R5442:Slc28a2b UTSW 2 122,317,350 (GRCm39) missense probably benign
R5795:Slc28a2b UTSW 2 122,348,475 (GRCm39) missense possibly damaging 0.79
R6258:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6260:Slc28a2b UTSW 2 122,353,963 (GRCm39) missense probably damaging 1.00
R6383:Slc28a2b UTSW 2 122,355,288 (GRCm39) missense probably benign 0.00
R7226:Slc28a2b UTSW 2 122,353,013 (GRCm39) missense probably benign 0.00
R7574:Slc28a2b UTSW 2 122,353,325 (GRCm39) missense not run
R7633:Slc28a2b UTSW 2 122,317,161 (GRCm39) missense probably null 0.05
R7705:Slc28a2b UTSW 2 122,352,110 (GRCm39) critical splice acceptor site probably null
R7726:Slc28a2b UTSW 2 122,317,214 (GRCm39) missense probably damaging 0.99
R7998:Slc28a2b UTSW 2 122,324,839 (GRCm39) missense probably damaging 0.97
R8269:Slc28a2b UTSW 2 122,352,169 (GRCm39) missense probably damaging 1.00
R8337:Slc28a2b UTSW 2 122,355,617 (GRCm39) missense probably benign 0.06
R8546:Slc28a2b UTSW 2 122,353,235 (GRCm39) missense probably benign 0.14
R8817:Slc28a2b UTSW 2 122,348,988 (GRCm39) missense possibly damaging 0.95
R8931:Slc28a2b UTSW 2 122,348,983 (GRCm39) missense
R9070:Slc28a2b UTSW 2 122,352,154 (GRCm39) missense probably damaging 1.00
R9542:Slc28a2b UTSW 2 122,324,822 (GRCm39) missense probably benign 0.26
R9702:Slc28a2b UTSW 2 122,354,012 (GRCm39) missense probably damaging 1.00
R9782:Slc28a2b UTSW 2 122,352,338 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGGGGTGAGGCACAGTCAAC -3'
(R):5'- AATGCCAGGTGGGAAGGTTAAGTTC -3'

Sequencing Primer
(F):5'- TGAGGCACAGTCAACATAATTGC -3'
(R):5'- TGGGAAGGTTAAGTTCAAACAAAAC -3'
Posted On 2013-05-09