Incidental Mutation 'R5442:Gm14085'
ID427212
Institutional Source Beutler Lab
Gene Symbol Gm14085
Ensembl Gene ENSMUSG00000079071
Gene Namepredicted gene 14085
Synonyms
MMRRC Submission 043007-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5442 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location122484941-122528040 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 122486869 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 36 (N36S)
Ref Sequence ENSEMBL: ENSMUSP00000106150 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110521]
Predicted Effect probably benign
Transcript: ENSMUST00000110521
AA Change: N36S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: N36S

DomainStartEndE-ValueType
transmembrane domain 76 98 N/A INTRINSIC
transmembrane domain 103 125 N/A INTRINSIC
transmembrane domain 149 166 N/A INTRINSIC
Pfam:Nucleos_tra2_N 180 253 2.3e-28 PFAM
Pfam:Gate 260 360 1.7e-10 PFAM
Pfam:Nucleos_tra2_C 363 587 4.6e-70 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132215
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk A G 11: 120,018,768 M114T probably benign Het
Ablim3 A T 18: 61,857,225 probably null Het
Adcy10 A G 1: 165,513,140 D238G probably benign Het
Astn2 G T 4: 65,581,786 S955R possibly damaging Het
Casc3 A G 11: 98,821,471 E112G probably damaging Het
Cetn4 C T 3: 37,309,945 V39I probably benign Het
Commd4 A G 9: 57,156,806 V37A possibly damaging Het
Dyrk2 T C 10: 118,860,738 Q205R possibly damaging Het
Gal3st4 A G 5: 138,265,780 V319A possibly damaging Het
Inpp5d G A 1: 87,718,066 A1058T probably benign Het
Lpin3 A G 2: 160,905,016 Y781C probably damaging Het
Lrat C T 3: 82,903,220 V165M probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Nlrp6 T C 7: 140,922,190 S142P probably benign Het
Oas1a T C 5: 120,897,206 T349A probably benign Het
Olfr1033 T C 2: 86,041,951 V212A probably benign Het
Olfr110 A T 17: 37,499,439 I263F probably damaging Het
Olfr671 A T 7: 104,975,228 F252L possibly damaging Het
Olfr898 T A 9: 38,349,862 S260T probably benign Het
Pakap C A 4: 57,637,876 P18Q probably null Het
Pcdha2 T C 18: 36,939,862 V182A probably benign Het
Phactr3 A G 2: 178,142,461 D26G probably benign Het
Phrf1 G A 7: 141,240,937 R159H probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rab3ip T C 10: 116,918,848 T268A probably benign Het
Rapgef3 T C 15: 97,758,861 D299G probably damaging Het
Rem1 A G 2: 152,628,057 probably null Het
Syne1 A G 10: 5,343,473 M1286T probably benign Het
Thsd7a T C 6: 12,748,800 T52A probably benign Het
Tmem135 A T 7: 89,144,664 F390Y probably damaging Het
Trio T C 15: 27,856,194 D696G probably benign Het
Ttll11 T C 2: 35,903,123 *191W probably null Het
Ubr4 A G 4: 139,407,772 D805G probably damaging Het
Usp9y A G Y: 1,336,467 I1469T possibly damaging Het
Vmn1r70 G T 7: 10,633,950 A122S possibly damaging Het
Vmn2r78 G T 7: 86,920,122 L74F possibly damaging Het
Wdfy3 T C 5: 101,896,559 E1860G probably benign Het
Other mutations in Gm14085
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00964:Gm14085 APN 2 122517046 missense probably damaging 0.98
IGL01160:Gm14085 APN 2 122524796 critical splice acceptor site probably null
IGL01838:Gm14085 APN 2 122517983 missense possibly damaging 0.65
IGL01895:Gm14085 APN 2 122525091 missense possibly damaging 0.75
IGL02999:Gm14085 APN 2 122514514 splice site probably benign
Wilted UTSW 2 122523482 missense probably damaging 1.00
K2124:Gm14085 UTSW 2 122525153 missense probably benign 0.00
R0084:Gm14085 UTSW 2 122522833 missense possibly damaging 0.95
R0092:Gm14085 UTSW 2 122517597 splice site probably benign
R0127:Gm14085 UTSW 2 122517069 critical splice donor site probably null
R0200:Gm14085 UTSW 2 122527447 makesense probably null
R0276:Gm14085 UTSW 2 122521928 missense probably damaging 1.00
R0309:Gm14085 UTSW 2 122517553 missense probably benign 0.04
R0403:Gm14085 UTSW 2 122521854 missense probably damaging 1.00
R0600:Gm14085 UTSW 2 122514398 missense probably damaging 0.97
R0612:Gm14085 UTSW 2 122521698 missense probably damaging 1.00
R1676:Gm14085 UTSW 2 122521859 missense probably damaging 0.99
R1801:Gm14085 UTSW 2 122521652 missense possibly damaging 0.57
R1986:Gm14085 UTSW 2 122527429 missense probably benign 0.00
R2050:Gm14085 UTSW 2 122522868 missense probably benign 0.21
R3078:Gm14085 UTSW 2 122514414 missense possibly damaging 0.63
R4075:Gm14085 UTSW 2 122514411 missense probably benign 0.00
R4096:Gm14085 UTSW 2 122522728 missense probably damaging 1.00
R4744:Gm14085 UTSW 2 122522805 nonsense probably null
R4796:Gm14085 UTSW 2 122514459 missense probably damaging 0.99
R5033:Gm14085 UTSW 2 122522914 critical splice donor site probably null
R5069:Gm14085 UTSW 2 122494373 missense possibly damaging 0.93
R5288:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5385:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5386:Gm14085 UTSW 2 122522778 missense probably benign 0.01
R5795:Gm14085 UTSW 2 122517994 missense possibly damaging 0.79
R6258:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6260:Gm14085 UTSW 2 122523482 missense probably damaging 1.00
R6383:Gm14085 UTSW 2 122524807 missense probably benign 0.00
R7226:Gm14085 UTSW 2 122522532 missense probably benign 0.00
R7574:Gm14085 UTSW 2 122522844 missense not run
R7633:Gm14085 UTSW 2 122486680 missense probably null 0.05
R7705:Gm14085 UTSW 2 122521629 critical splice acceptor site probably null
R7726:Gm14085 UTSW 2 122486733 missense probably damaging 0.99
R7998:Gm14085 UTSW 2 122494358 missense probably damaging 0.97
R8269:Gm14085 UTSW 2 122521688 missense probably damaging 1.00
R8337:Gm14085 UTSW 2 122525136 missense probably benign 0.06
R8546:Gm14085 UTSW 2 122522754 missense probably benign 0.14
R8817:Gm14085 UTSW 2 122518507 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AGAAAGTCTGTTTCCCAGGC -3'
(R):5'- AACATGCAGTGATCCTGGTCC -3'

Sequencing Primer
(F):5'- TCTGTTTCCCAGGCCAGAGTG -3'
(R):5'- GTCCTGACTGTGAGTTAAGCAATC -3'
Posted On2016-09-01