Mutagenetix > Incidental Mutation

Incidental Mutation 'R5442:Gm14085'

427212

Institutional Source

Beutler Lab

Gene Symbol

Gm14085

Ensembl Gene

ENSMUSG00000079071

Gene Name

predicted gene 14085

Synonyms

MMRRC Submission

043007-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.068) question?

Stock #

R5442 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

122484941-122528040 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 122486869 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 36 (N36S)

Ref Sequence

ENSEMBL: ENSMUSP00000106150 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110521]

AlphaFold

A2AWR5

Predicted Effect

probably benign
Transcript: ENSMUST00000110521
AA Change: N36S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000106150
Gene: ENSMUSG00000079071
AA Change: N36S

Domain	Start	End	E-Value	Type
transmembrane domain	76	98	N/A	INTRINSIC
transmembrane domain	103	125	N/A	INTRINSIC
transmembrane domain	149	166	N/A	INTRINSIC
Pfam:Nucleos_tra2_N	180	253	2.3e-28	PFAM
Pfam:Gate	260	360	1.7e-10	PFAM
Pfam:Nucleos_tra2_C	363	587	4.6e-70	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132215

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 37 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	A	G	11: 120,018,768	M114T	probably benign	Het
Ablim3	A	T	18: 61,857,225		probably null	Het
Adcy10	A	G	1: 165,513,140	D238G	probably benign	Het
Astn2	G	T	4: 65,581,786	S955R	possibly damaging	Het
Casc3	A	G	11: 98,821,471	E112G	probably damaging	Het
Cetn4	C	T	3: 37,309,945	V39I	probably benign	Het
Commd4	A	G	9: 57,156,806	V37A	possibly damaging	Het
Dyrk2	T	C	10: 118,860,738	Q205R	possibly damaging	Het
Gal3st4	A	G	5: 138,265,780	V319A	possibly damaging	Het
Inpp5d	G	A	1: 87,718,066	A1058T	probably benign	Het
Lpin3	A	G	2: 160,905,016	Y781C	probably damaging	Het
Lrat	C	T	3: 82,903,220	V165M	probably damaging	Het
Ltbr	G	A	6: 125,312,794	R146W	probably damaging	Het
Nlrp6	T	C	7: 140,922,190	S142P	probably benign	Het
Oas1a	T	C	5: 120,897,206	T349A	probably benign	Het
Olfr1033	T	C	2: 86,041,951	V212A	probably benign	Het
Olfr110	A	T	17: 37,499,439	I263F	probably damaging	Het
Olfr671	A	T	7: 104,975,228	F252L	possibly damaging	Het
Olfr898	T	A	9: 38,349,862	S260T	probably benign	Het
Pakap	C	A	4: 57,637,876	P18Q	probably null	Het
Pcdha2	T	C	18: 36,939,862	V182A	probably benign	Het
Phactr3	A	G	2: 178,142,461	D26G	probably benign	Het
Phrf1	G	A	7: 141,240,937	R159H	probably damaging	Het
R3hdm4	C	T	10: 79,912,458	E162K	possibly damaging	Het
Rab3ip	T	C	10: 116,918,848	T268A	probably benign	Het
Rapgef3	T	C	15: 97,758,861	D299G	probably damaging	Het
Rem1	A	G	2: 152,628,057		probably null	Het
Syne1	A	G	10: 5,343,473	M1286T	probably benign	Het
Thsd7a	T	C	6: 12,748,800	T52A	probably benign	Het
Tmem135	A	T	7: 89,144,664	F390Y	probably damaging	Het
Trio	T	C	15: 27,856,194	D696G	probably benign	Het
Ttll11	T	C	2: 35,903,123	*191W	probably null	Het
Ubr4	A	G	4: 139,407,772	D805G	probably damaging	Het
Usp9y	A	G	Y: 1,336,467	I1469T	possibly damaging	Het
Vmn1r70	G	T	7: 10,633,950	A122S	possibly damaging	Het
Vmn2r78	G	T	7: 86,920,122	L74F	possibly damaging	Het
Wdfy3	T	C	5: 101,896,559	E1860G	probably benign	Het

Other mutations in Gm14085

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00964:Gm14085	APN	2	122517046	missense	probably damaging	0.98
IGL01160:Gm14085	APN	2	122524796	critical splice acceptor site	probably null
IGL01838:Gm14085	APN	2	122517983	missense	possibly damaging	0.65
IGL01895:Gm14085	APN	2	122525091	missense	possibly damaging	0.75
IGL02999:Gm14085	APN	2	122514514	splice site	probably benign
Wilted	UTSW	2	122523482	missense	probably damaging	1.00
K2124:Gm14085	UTSW	2	122525153	missense	probably benign	0.00
R0084:Gm14085	UTSW	2	122522833	missense	possibly damaging	0.95
R0092:Gm14085	UTSW	2	122517597	splice site	probably benign
R0127:Gm14085	UTSW	2	122517069	critical splice donor site	probably null
R0200:Gm14085	UTSW	2	122527447	makesense	probably null
R0276:Gm14085	UTSW	2	122521928	missense	probably damaging	1.00
R0309:Gm14085	UTSW	2	122517553	missense	probably benign	0.04
R0403:Gm14085	UTSW	2	122521854	missense	probably damaging	1.00
R0600:Gm14085	UTSW	2	122514398	missense	probably damaging	0.97
R0612:Gm14085	UTSW	2	122521698	missense	probably damaging	1.00
R1676:Gm14085	UTSW	2	122521859	missense	probably damaging	0.99
R1801:Gm14085	UTSW	2	122521652	missense	possibly damaging	0.57
R1986:Gm14085	UTSW	2	122527429	missense	probably benign	0.00
R2050:Gm14085	UTSW	2	122522868	missense	probably benign	0.21
R3078:Gm14085	UTSW	2	122514414	missense	possibly damaging	0.63
R4075:Gm14085	UTSW	2	122514411	missense	probably benign	0.00
R4096:Gm14085	UTSW	2	122522728	missense	probably damaging	1.00
R4744:Gm14085	UTSW	2	122522805	nonsense	probably null
R4796:Gm14085	UTSW	2	122514459	missense	probably damaging	0.99
R5033:Gm14085	UTSW	2	122522914	critical splice donor site	probably null
R5069:Gm14085	UTSW	2	122494373	missense	possibly damaging	0.93
R5288:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5385:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5386:Gm14085	UTSW	2	122522778	missense	probably benign	0.01
R5795:Gm14085	UTSW	2	122517994	missense	possibly damaging	0.79
R6258:Gm14085	UTSW	2	122523482	missense	probably damaging	1.00
R6260:Gm14085	UTSW	2	122523482	missense	probably damaging	1.00
R6383:Gm14085	UTSW	2	122524807	missense	probably benign	0.00
R7226:Gm14085	UTSW	2	122522532	missense	probably benign	0.00
R7574:Gm14085	UTSW	2	122522844	missense	not run
R7633:Gm14085	UTSW	2	122486680	missense	probably null	0.05
R7705:Gm14085	UTSW	2	122521629	critical splice acceptor site	probably null
R7726:Gm14085	UTSW	2	122486733	missense	probably damaging	0.99
R7998:Gm14085	UTSW	2	122494358	missense	probably damaging	0.97
R8269:Gm14085	UTSW	2	122521688	missense	probably damaging	1.00
R8337:Gm14085	UTSW	2	122525136	missense	probably benign	0.06
R8546:Gm14085	UTSW	2	122522754	missense	probably benign	0.14
R8817:Gm14085	UTSW	2	122518507	missense	possibly damaging	0.95
R8931:Gm14085	UTSW	2	122518502	missense
R9070:Gm14085	UTSW	2	122521673	missense	probably damaging	1.00
R9542:Gm14085	UTSW	2	122494341	missense	probably benign	0.26
R9702:Gm14085	UTSW	2	122523531	missense	probably damaging	1.00
R9782:Gm14085	UTSW	2	122521857	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGAAAGTCTGTTTCCCAGGC -3'
(R):5'- AACATGCAGTGATCCTGGTCC -3'

Sequencing Primer
(F):5'- TCTGTTTCCCAGGCCAGAGTG -3'
(R):5'- GTCCTGACTGTGAGTTAAGCAATC -3'

Posted On

2016-09-01