Incidental Mutation 'R0276:Adamts13'
ID35346
Institutional Source Beutler Lab
Gene Symbol Adamts13
Ensembl Gene ENSMUSG00000014852
Gene Namea disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13
SynonymsvWF-CP mRNA for von Willebrand factor-cleaving, LOC279028
MMRRC Submission 038498-MU
Accession Numbers

NCBI RefSeq: NM_001001322.2; MGI:2685556

Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R0276 (G1)
Quality Score223
Status Validated
Chromosome2
Chromosomal Location26973416-27009628 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 26975760 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 109 (N109S)
Ref Sequence ENSEMBL: ENSMUSP00000014996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014996] [ENSMUST00000102891]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014996
AA Change: N109S

PolyPhen 2 Score 0.907 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014996
Gene: ENSMUSG00000014852
AA Change: N109S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 2.3e-11 PFAM
Pfam:Reprolysin 84 291 1e-15 PFAM
Pfam:Reprolysin_3 113 237 2e-10 PFAM
Pfam:Reprolysin_2 132 281 5e-9 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000102891
AA Change: N109S

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000099955
Gene: ENSMUSG00000014852
AA Change: N109S

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Reprolysin_4 84 287 8.5e-11 PFAM
Pfam:Reprolysin 96 291 4.9e-14 PFAM
Pfam:Reprolysin_3 106 237 5.6e-11 PFAM
TSP1 392 444 3.29e-14 SMART
TSP1 693 748 7.01e0 SMART
TSP1 750 810 3.34e-6 SMART
TSP1 904 959 5.85e0 SMART
TSP1 961 1019 2.69e0 SMART
Blast:TSP1 1022 1079 4e-26 BLAST
TSP1 1081 1137 4.58e-4 SMART
Blast:CUB 1196 1293 2e-39 BLAST
Blast:CUB 1303 1412 3e-63 BLAST
Meta Mutation Damage Score 0.2777 question?
Coding Region Coverage
  • 1x: 98.7%
  • 3x: 97.8%
  • 10x: 96.2%
  • 20x: 93.8%
Validation Efficiency 98% (101/103)
MGI Phenotype FUNCTION: This gene encodes a member of "a disintegrin and metalloproteinase with thrombospondin motifs" (ADAMTS) family of multi-domain matrix-associated metalloendopeptidases that have diverse roles in tissue morphogenesis and pathophysiological remodeling, in inflammation and in vascular biology. In certain mouse strains (C57BL/6, for example) an intracisternal A-type particle (IAP) retrotransposon sequence is located in the intron 23 that causes an alternate splicing event resulting in a shorter transcript variants encoding shorter isoforms. The encoded preproprotein undergoes proteolytic processing to generate an active enzyme that cleaves von Willebrand factor (VWF) in circulating blood. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygous mutation of this gene results in thrombocytopenia, decreased survival, and increased susceptibility to developing thrombotic thrombocytopenic purpura after shiga toxin injection. On a different background, mutants are viable and fertile. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Targeted(7) Gene trapped(2) Spontaneous(1)

Other mutations in this stock
Total: 100 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy10 T A 1: 165,572,591 M1523K possibly damaging Het
Agtpbp1 C T 13: 59,462,031 S1095N possibly damaging Het
Ang2 C T 14: 51,195,518 V136I probably damaging Het
Arhgap10 A T 8: 77,413,581 M250K probably benign Het
Arhgap33 A T 7: 30,523,244 W1088R probably benign Het
Arhgef15 T C 11: 68,953,472 probably benign Het
Aspm T C 1: 139,478,471 S1699P possibly damaging Het
Atp12a C A 14: 56,387,694 D1014E probably damaging Het
Atp1a4 T A 1: 172,257,901 K45M probably damaging Het
Atp8a1 A T 5: 67,786,673 probably benign Het
Baiap3 A C 17: 25,243,687 F1099C probably damaging Het
Bcas3 T A 11: 85,470,837 probably null Het
Bms1 G A 6: 118,408,134 T371M possibly damaging Het
Camta1 C A 4: 151,075,140 R1614L probably damaging Het
Capn3 T C 2: 120,488,065 probably benign Het
Ccdc180 A G 4: 45,923,534 D1105G probably damaging Het
Ccdc33 G T 9: 58,058,392 P364Q probably damaging Het
Ccdc36 A T 9: 108,428,440 M11K possibly damaging Het
Clstn3 A G 6: 124,431,740 probably benign Het
Cntrl A T 2: 35,151,732 Y619F possibly damaging Het
Col12a1 A T 9: 79,630,741 Y2514* probably null Het
Cpt1b T C 15: 89,419,959 H503R probably benign Het
Crb1 T A 1: 139,323,335 T293S possibly damaging Het
D130043K22Rik C T 13: 24,858,045 T319I possibly damaging Het
Dzip1l G A 9: 99,660,998 R502Q probably benign Het
Efcab5 A G 11: 77,129,876 M673T probably damaging Het
Efcab5 G A 11: 77,140,923 R42W probably damaging Het
F2rl3 A G 8: 72,762,798 T218A probably benign Het
Fam135a C T 1: 24,067,964 R31H probably damaging Het
Fam84b G T 15: 60,823,674 Y74* probably null Het
Fcer2a A T 8: 3,689,811 N53K possibly damaging Het
Gm14085 T A 2: 122,521,928 S389T probably damaging Het
Golgb1 A C 16: 36,913,876 K1162Q probably damaging Het
Gpr137b A T 13: 13,367,575 probably benign Het
Haspin A T 11: 73,136,487 L592Q probably damaging Het
Helq A G 5: 100,790,147 F478L probably damaging Het
Il17rb T A 14: 30,004,380 T84S probably damaging Het
Itga4 T C 2: 79,321,493 L880P probably damaging Het
Itih5 A G 2: 10,185,564 I61V possibly damaging Het
Ivl G A 3: 92,571,514 L415F unknown Het
Kif2a A G 13: 106,976,650 probably benign Het
Kmt2d T C 15: 98,850,311 probably benign Het
Lars2 A G 9: 123,438,121 probably benign Het
Lilrb4a T C 10: 51,491,581 V73A probably benign Het
Lrrc8a A G 2: 30,256,788 D538G possibly damaging Het
Lrrk1 G A 7: 66,296,263 probably benign Het
Mc2r A T 18: 68,408,132 I30K possibly damaging Het
Mybbp1a C A 11: 72,450,107 probably null Het
Napg C T 18: 62,986,963 R149C probably damaging Het
Ncam2 A G 16: 81,517,629 probably benign Het
Nlk T C 11: 78,571,475 I509V probably benign Het
Nlrp2 A T 7: 5,328,109 N429K probably benign Het
Nlrp9b A G 7: 20,028,498 T247A probably benign Het
Noxo1 A T 17: 24,700,162 probably null Het
Olfr1212 T A 2: 88,958,755 C96* probably null Het
Olfr139 A G 11: 74,045,118 I52T probably damaging Het
Olfr353 A T 2: 36,890,023 M275K probably benign Het
Olfr701 A T 7: 106,818,697 I205L probably benign Het
Olfr734 C A 14: 50,320,179 A219S probably benign Het
Oxr1 T C 15: 41,820,062 S294P probably damaging Het
Pfpl A G 19: 12,429,237 Y284C probably damaging Het
Pi16 A T 17: 29,326,943 T232S probably benign Het
Plcxd2 A T 16: 46,009,707 N50K probably benign Het
Plekhn1 T A 4: 156,228,246 N52Y probably damaging Het
Prl2c5 T C 13: 13,183,049 probably benign Het
Prrc2b G A 2: 32,219,654 V1080I probably damaging Het
Psg28 A T 7: 18,430,396 N130K probably benign Het
Psme4 C A 11: 30,811,980 T440K probably damaging Het
Ptcd2 T C 13: 99,321,596 K296E probably benign Het
Ptprq T C 10: 107,542,735 probably null Het
Rab5b A C 10: 128,686,746 probably null Het
Rft1 T A 14: 30,690,583 S534T probably benign Het
Rif1 GCCACCA GCCA 2: 52,110,324 probably benign Het
Rsu1 A T 2: 13,170,135 probably benign Het
Senp6 A G 9: 80,136,747 M887V probably benign Het
Sgcz T A 8: 37,952,919 M60L probably benign Het
Siglec1 G A 2: 131,083,941 Q282* probably null Het
Sipa1l2 T C 8: 125,421,940 T1655A probably damaging Het
Slc43a3 G A 2: 84,937,663 probably benign Het
Snx29 T C 16: 11,738,373 V756A probably benign Het
Spta1 T A 1: 174,217,894 H1539Q probably damaging Het
Stk3 A C 15: 35,099,469 S104A probably damaging Het
Stk38 C A 17: 28,992,416 probably null Het
Stx6 T C 1: 155,174,163 probably benign Het
Thbs4 G A 13: 92,775,532 T230I probably benign Het
Thrsp A G 7: 97,417,502 M1T probably null Het
Tmem63b A T 17: 45,675,373 probably benign Het
Top2a A G 11: 99,009,907 probably benign Het
Tpd52l2 T C 2: 181,502,059 probably null Het
Trak1 A G 9: 121,454,338 E390G probably damaging Het
Trappc3 T A 4: 126,273,952 D101E possibly damaging Het
Trhr A G 15: 44,197,086 M1V probably null Het
Triobp T A 15: 78,973,676 I1159K probably benign Het
Unc45a A G 7: 80,326,297 probably benign Het
Usb1 A G 8: 95,333,457 D12G probably damaging Het
Ushbp1 C T 8: 71,394,649 C113Y possibly damaging Het
Vim A G 2: 13,574,859 K143R probably benign Het
Vmn2r75 T C 7: 86,148,307 K766R probably benign Het
Wdr92 T C 11: 17,229,821 I274T probably benign Het
Xpo5 T G 17: 46,241,507 C1089G probably damaging Het
Other mutations in Adamts13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Adamts13 APN 2 27005361 missense probably benign 0.04
IGL00465:Adamts13 APN 2 26973555 missense probably benign 0.32
IGL01114:Adamts13 APN 2 27005190 missense probably benign 0.41
IGL01138:Adamts13 APN 2 26983042 missense probably damaging 1.00
IGL01154:Adamts13 APN 2 27006194 missense probably benign
IGL01860:Adamts13 APN 2 26978011 missense probably damaging 0.99
IGL01924:Adamts13 APN 2 26996583 missense possibly damaging 0.80
IGL01991:Adamts13 APN 2 26990598 missense probably damaging 0.97
IGL02215:Adamts13 APN 2 26985483 missense probably damaging 1.00
IGL02415:Adamts13 APN 2 26989283 missense possibly damaging 0.95
IGL02519:Adamts13 APN 2 26978675 missense probably damaging 1.00
IGL02956:Adamts13 APN 2 26983037 missense probably benign 0.18
IGL03209:Adamts13 APN 2 26992961 missense probably benign 0.00
I1329:Adamts13 UTSW 2 26973619 missense possibly damaging 0.52
IGL02837:Adamts13 UTSW 2 26991420 missense probably benign 0.01
IGL03048:Adamts13 UTSW 2 26978699 critical splice donor site probably null
R0041:Adamts13 UTSW 2 26983974 missense probably damaging 1.00
R0217:Adamts13 UTSW 2 26996921 splice site probably benign
R0309:Adamts13 UTSW 2 26986989 missense probably damaging 0.99
R0348:Adamts13 UTSW 2 26981080 missense probably benign 0.13
R0369:Adamts13 UTSW 2 27005186 missense probably benign 0.00
R0386:Adamts13 UTSW 2 26986679 splice site probably null
R0553:Adamts13 UTSW 2 26991334 nonsense probably null
R0714:Adamts13 UTSW 2 26986985 splice site probably benign
R0862:Adamts13 UTSW 2 27006324 critical splice donor site probably null
R1320:Adamts13 UTSW 2 26989246 missense probably damaging 0.97
R1458:Adamts13 UTSW 2 26988354 missense probably damaging 1.00
R1473:Adamts13 UTSW 2 26981753 nonsense probably null
R1491:Adamts13 UTSW 2 26978315 missense probably damaging 1.00
R1588:Adamts13 UTSW 2 26975675 missense probably benign 0.01
R1638:Adamts13 UTSW 2 26996583 missense possibly damaging 0.80
R1724:Adamts13 UTSW 2 26991294 missense probably benign 0.00
R1924:Adamts13 UTSW 2 26984141 missense probably damaging 1.00
R2001:Adamts13 UTSW 2 26973990 missense probably benign
R2072:Adamts13 UTSW 2 27005425 missense probably benign 0.10
R2073:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R2409:Adamts13 UTSW 2 26978362 missense probably benign 0.00
R4362:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4363:Adamts13 UTSW 2 27004782 missense probably damaging 1.00
R4422:Adamts13 UTSW 2 27005400 missense probably benign 0.00
R4769:Adamts13 UTSW 2 27008711 nonsense probably null
R4785:Adamts13 UTSW 2 26983042 missense probably damaging 1.00
R4831:Adamts13 UTSW 2 26983130 critical splice donor site probably null
R4832:Adamts13 UTSW 2 26989402 missense probably benign 0.22
R4945:Adamts13 UTSW 2 26986610 missense probably damaging 1.00
R5047:Adamts13 UTSW 2 26996910 missense probably damaging 0.98
R5126:Adamts13 UTSW 2 26996915 critical splice donor site probably null
R5161:Adamts13 UTSW 2 26993008 missense probably benign 0.00
R5394:Adamts13 UTSW 2 26986558 missense probably benign 0.00
R5557:Adamts13 UTSW 2 26973639 missense probably benign 0.05
R5660:Adamts13 UTSW 2 26996749 missense probably benign
R5890:Adamts13 UTSW 2 26986591 missense probably damaging 0.96
R6168:Adamts13 UTSW 2 27004886 missense probably benign 0.37
R6536:Adamts13 UTSW 2 26975750 missense probably damaging 0.99
R6929:Adamts13 UTSW 2 27006263 nonsense probably null
R7207:Adamts13 UTSW 2 26978695 missense probably damaging 1.00
R7211:Adamts13 UTSW 2 26989298 missense probably benign 0.40
R7212:Adamts13 UTSW 2 27006314 missense probably damaging 1.00
R7392:Adamts13 UTSW 2 26989324 missense probably damaging 1.00
R7583:Adamts13 UTSW 2 26973953 missense probably benign
R7604:Adamts13 UTSW 2 27005206 missense probably benign 0.00
R7783:Adamts13 UTSW 2 26990585 missense not run
R7814:Adamts13 UTSW 2 26996549 missense probably benign
R8076:Adamts13 UTSW 2 26990612 missense probably benign 0.06
R8245:Adamts13 UTSW 2 26990556 missense probably damaging 1.00
X0027:Adamts13 UTSW 2 26985546 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACCTGCTTTCCAGCCTGAACTG -3'
(R):5'- ACTCACCGTGCTCAAATGTACTGAC -3'

Sequencing Primer
(F):5'- CGACATGAAATCAGCCTTTTGAC -3'
(R):5'- GCTCAAATGTACTGACTTGTGACC -3'
Posted On2013-05-09