Mutagenetix > Incidental Mutations

Incidental Mutation 'R4691:Tet2'

354895

Institutional Source

Beutler Lab

Gene Symbol

Tet2

Ensembl Gene

ENSMUSG00000040943

Gene Name

tet methylcytosine dioxygenase 2

Synonyms

E130014J05Rik, Ayu17-449

MMRRC Submission

041942-MU

Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4691 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

133463679-133545139 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 133486083 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Histidine at position 863 (Q863H)

Ref Sequence

ENSEMBL: ENSMUSP00000143029 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398] [ENSMUST00000197118]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000098603
AA Change: Q863H

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: Q863H

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1203	1819	7e-301	SMART
low complexity region	1832	1844	N/A	INTRINSIC
low complexity region	1885	1897	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000196398
AA Change: Q863H

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: Q863H

Domain	Start	End	E-Value	Type
low complexity region	690	701	N/A	INTRINSIC
low complexity region	855	862	N/A	INTRINSIC
low complexity region	884	895	N/A	INTRINSIC
low complexity region	899	921	N/A	INTRINSIC
Tet_JBP	1211	1827	3.4e-305	SMART
low complexity region	1840	1852	N/A	INTRINSIC
low complexity region	1893	1905	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000197118

Meta Mutation Damage Score

0.1795

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 95.0%

Validation Efficiency

97% (70/72)

MGI Phenotype

Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]

Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A530032D15Rik	C	T	1: 85,088,800		probably benign	Het
Abca13	A	T	11: 9,434,195	R3882S	probably damaging	Het
Adamts2	G	T	11: 50,756,696	V299F	probably damaging	Het
Ankrd50	A	G	3: 38,483,010	S65P	probably benign	Het
Ap4e1	T	C	2: 127,061,871	C898R	probably benign	Het
Arel1	A	T	12: 84,930,249		probably null	Het
Bag6	T	A	17: 35,139,248	V164D	probably damaging	Het
C2cd5	A	G	6: 143,030,148	S769P	possibly damaging	Het
Cables1	C	T	18: 11,840,523	Q240*	probably null	Het
Ccnb1-ps	T	A	7: 42,106,092		noncoding transcript	Het
Ccz1	A	T	5: 143,991,562	I390N	possibly damaging	Het
Ces1a	T	C	8: 93,032,659	H283R	probably benign	Het
Clca3b	G	A	3: 144,839,092	T378I	probably benign	Het
Cpne2	A	T	8: 94,558,221	I342F	probably damaging	Het
Cyp2d9	A	G	15: 82,455,832	D141G	probably damaging	Het
Ddias	T	A	7: 92,858,816	K630N	probably damaging	Het
Dennd4b	A	G	3: 90,272,312	T626A	probably damaging	Het
Disc1	T	C	8: 125,148,447	V554A	possibly damaging	Het
Dnah10	A	G	5: 124,775,517	T1880A	probably damaging	Het
Dnase1l1	C	T	X: 74,277,038		probably null	Het
Epop	C	T	11: 97,628,893	G130D	possibly damaging	Het
Erap1	T	C	13: 74,673,692	L722P	probably damaging	Het
Eya4	T	A	10: 23,140,068	T334S	probably benign	Het
Ezr	T	C	17: 6,759,562	I5V	probably benign	Het
Fam53c	A	C	18: 34,768,690	E220A	probably damaging	Het
Galnt12	T	C	4: 47,104,143	S134P	probably damaging	Het
Gcfc2	T	A	6: 81,941,427	L366*	probably null	Het
Gins4	T	A	8: 23,237,059	D6V	probably benign	Het
Gm1113	T	C	9: 35,516,862	S106G	possibly damaging	Het
Gm5155	T	A	7: 17,908,966	S434T	possibly damaging	Het
Grid1	A	G	14: 35,569,557	H807R	probably benign	Het
H2-T22	GTTTT	GTTT	17: 36,041,570		probably null	Het
Ighv1-66	T	C	12: 115,593,309	Y51C	probably benign	Het
Inpp4b	A	T	8: 82,122,653	Y901F	probably damaging	Het
Irf2	T	A	8: 46,846,187	S339T	probably damaging	Het
Itgae	G	T	11: 73,119,519	G612*	probably null	Het
Kdr	T	C	5: 75,944,599	K1037R	possibly damaging	Het
Mro	A	T	18: 73,873,326	M115L	probably benign	Het
Myo5a	A	G	9: 75,180,156	E1098G	probably damaging	Het
Nkx2-1	T	A	12: 56,533,565	M197L	probably benign	Het
Olfr58	T	C	9: 19,783,382	I83T	probably benign	Het
Pank2	T	A	2: 131,296,281	F430L	possibly damaging	Het
Pcx	T	A	19: 4,619,477	V794E	probably damaging	Het
Pdgfd	C	T	9: 6,288,556	P70L	probably damaging	Het
Pla2g4e	T	C	2: 120,174,300	Y521C	probably damaging	Het
Pou5f1	T	A	17: 35,506,131	F11Y	probably damaging	Het
Prdm9	A	G	17: 15,553,378	M252T	probably benign	Het
Ptk2b	C	T	14: 66,157,069	G859S	probably benign	Het
Rad51ap1	A	G	6: 126,927,553	S123P	probably benign	Het
Robo3	T	C	9: 37,425,218	E418G	probably damaging	Het
Sos2	C	T	12: 69,616,328	R631H	probably damaging	Het
St3gal2	C	T	8: 110,957,785	T25I	probably benign	Het
Stra6l	G	A	4: 45,882,851	A521T	probably benign	Het
Syt7	T	A	19: 10,426,481	L177Q	probably damaging	Het
Tmem232	T	C	17: 65,265,242	K585E	possibly damaging	Het
Trpc6	A	C	9: 8,652,978	E595A	probably damaging	Het
Txnl1	A	G	18: 63,671,679	V248A	possibly damaging	Het
Vmn2r72	A	T	7: 85,737,911	L815*	probably null	Het
Vmn2r81	C	T	10: 79,293,377	Q701*	probably null	Het
Vps13c	T	C	9: 67,952,935	V2811A	possibly damaging	Het
Zfp354a	A	G	11: 51,070,237	E425G	probably damaging	Het
Zfp617	A	T	8: 71,932,815	T330S	probably benign	Het
Zfp663	G	T	2: 165,359,130		probably benign	Het
Zfp84	T	C	7: 29,777,080	L399P	probably damaging	Het
Zfp869	A	T	8: 69,706,863	C353*	probably null	Het
Zscan22	C	T	7: 12,906,561	A85V	probably benign	Het

Other mutations in Tet2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00341:Tet2	APN	3	133488085	missense	possibly damaging	0.96
IGL00401:Tet2	APN	3	133466882	missense	possibly damaging	0.72
IGL01528:Tet2	APN	3	133480298	missense	possibly damaging	0.86
IGL02053:Tet2	APN	3	133488523	missense	possibly damaging	0.96
IGL02142:Tet2	APN	3	133480139	missense	possibly damaging	0.96
IGL02512:Tet2	APN	3	133469308	missense	probably benign	0.05
IGL03148:Tet2	APN	3	133481363	missense	probably benign	0.18
IGL03182:Tet2	APN	3	133471398	nonsense	probably null
IGL03371:Tet2	APN	3	133467551	missense	possibly damaging	0.71
P0022:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0023:Tet2	UTSW	3	133486893	missense	probably benign	0.01
P0031:Tet2	UTSW	3	133480202	missense	possibly damaging	0.53
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0012:Tet2	UTSW	3	133476558	missense	probably damaging	0.98
R0463:Tet2	UTSW	3	133486666	missense	possibly damaging	0.86
R0522:Tet2	UTSW	3	133466804	missense	probably damaging	0.98
R0593:Tet2	UTSW	3	133488109	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467602	missense	probably benign	0.00
R0600:Tet2	UTSW	3	133467725	missense	probably benign	0.01
R0698:Tet2	UTSW	3	133467384	missense	probably benign	0.32
R0723:Tet2	UTSW	3	133467284	missense	probably benign
R0726:Tet2	UTSW	3	133468184	missense	probably benign
R0747:Tet2	UTSW	3	133467470	missense	possibly damaging	0.86
R1006:Tet2	UTSW	3	133476601	missense	possibly damaging	0.53
R1382:Tet2	UTSW	3	133476615	missense	probably damaging	1.00
R1455:Tet2	UTSW	3	133473645	missense	possibly damaging	0.51
R1550:Tet2	UTSW	3	133469519	missense	probably benign	0.32
R1647:Tet2	UTSW	3	133485880	missense	probably benign
R1662:Tet2	UTSW	3	133466852	missense	possibly damaging	0.96
R1727:Tet2	UTSW	3	133487290	missense	probably damaging	0.98
R1738:Tet2	UTSW	3	133481387	missense	probably benign	0.08
R1749:Tet2	UTSW	3	133480131	critical splice donor site	probably null
R1869:Tet2	UTSW	3	133481441	splice site	probably null
R1887:Tet2	UTSW	3	133487333	missense	possibly damaging	0.68
R1937:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1939:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1940:Tet2	UTSW	3	133488638	missense	possibly damaging	0.68
R1997:Tet2	UTSW	3	133486589	nonsense	probably null
R2082:Tet2	UTSW	3	133485727	missense	possibly damaging	0.96
R2084:Tet2	UTSW	3	133487767	missense	possibly damaging	0.68
R2215:Tet2	UTSW	3	133486601	missense	probably benign	0.03
R2321:Tet2	UTSW	3	133486339	missense	possibly damaging	0.53
R2873:Tet2	UTSW	3	133486954	missense	probably damaging	1.00
R3439:Tet2	UTSW	3	133466831	missense	possibly damaging	0.93
R3783:Tet2	UTSW	3	133479363	missense	possibly damaging	0.53
R3894:Tet2	UTSW	3	133469477	missense	possibly damaging	0.86
R3916:Tet2	UTSW	3	133486055	missense	possibly damaging	0.53
R3966:Tet2	UTSW	3	133487657	missense	possibly damaging	0.73
R4457:Tet2	UTSW	3	133485563	missense	possibly damaging	0.85
R4633:Tet2	UTSW	3	133485549	missense	probably benign	0.33
R4646:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4647:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4648:Tet2	UTSW	3	133488082	missense	probably benign	0.02
R4805:Tet2	UTSW	3	133467315	missense	probably benign	0.32
R4829:Tet2	UTSW	3	133476620	missense	possibly damaging	0.91
R4901:Tet2	UTSW	3	133467044	missense	possibly damaging	0.86
R4975:Tet2	UTSW	3	133486759	unclassified	probably benign
R5004:Tet2	UTSW	3	133487379	missense	possibly damaging	0.84
R5075:Tet2	UTSW	3	133486906	missense	probably benign
R5137:Tet2	UTSW	3	133476565	missense	probably benign	0.32
R5324:Tet2	UTSW	3	133485913	missense	probably benign	0.00
R5590:Tet2	UTSW	3	133476480	splice site	probably null
R5854:Tet2	UTSW	3	133487885	missense	probably damaging	0.98
R5856:Tet2	UTSW	3	133486640	missense	probably benign	0.01
R5865:Tet2	UTSW	3	133487099	missense	probably benign	0.08
R5879:Tet2	UTSW	3	133487960	missense	possibly damaging	0.96
R5935:Tet2	UTSW	3	133488535	missense	possibly damaging	0.68
R6012:Tet2	UTSW	3	133466781	missense	possibly damaging	0.86
R6075:Tet2	UTSW	3	133471435	missense	possibly damaging	0.71
R6181:Tet2	UTSW	3	133487759	nonsense	probably null
R6188:Tet2	UTSW	3	133480326	missense	probably benign	0.18
R6339:Tet2	UTSW	3	133486417	missense	possibly damaging	0.53
R6612:Tet2	UTSW	3	133487335	missense	possibly damaging	0.53
R6923:Tet2	UTSW	3	133479341	critical splice donor site	probably null
R6934:Tet2	UTSW	3	133483237	critical splice donor site	probably null
R7076:Tet2	UTSW	3	133467023	missense	possibly damaging	0.71
R7155:Tet2	UTSW	3	133469591	missense	possibly damaging	0.71
R7184:Tet2	UTSW	3	133473630	missense	probably damaging	0.98
R7200:Tet2	UTSW	3	133487192	missense	probably benign	0.18
R7459:Tet2	UTSW	3	133480289	missense	possibly damaging	0.53
R7504:Tet2	UTSW	3	133487339	missense	probably benign	0.33
R7524:Tet2	UTSW	3	133480229	missense	probably benign	0.33
R7613:Tet2	UTSW	3	133466748	missense	possibly damaging	0.83
R7653:Tet2	UTSW	3	133486385	missense	probably benign	0.18
R7691:Tet2	UTSW	3	133486849	missense	probably damaging	0.98
R7770:Tet2	UTSW	3	133480295	missense	possibly damaging	0.53
R7807:Tet2	UTSW	3	133486541	missense	possibly damaging	0.53
R7813:Tet2	UTSW	3	133473643	missense	probably benign	0.06
X0021:Tet2	UTSW	3	133486295	missense	possibly damaging	0.85
X0066:Tet2	UTSW	3	133488373	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- GTCTTGATTGGCCTAAGCATC -3'
(R):5'- AGCGGGAACAAGCTCTACATC -3'

Sequencing Primer
(F):5'- GGCCTAAGCATCTGGTTATGACC -3'
(R):5'- CGTAGGAAGTAAGACCTCAAACCTG -3'

Posted On

2015-10-21