Incidental Mutation 'R1455:Tet2'
ID161708
Institutional Source Beutler Lab
Gene Symbol Tet2
Ensembl Gene ENSMUSG00000040943
Gene Nametet methylcytosine dioxygenase 2
SynonymsE130014J05Rik, Ayu17-449
MMRRC Submission 039510-MU
Accession Numbers

Ncbi RefSeq: NM_001040400.2; MGI:2443298

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1455 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location133463679-133545139 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 133473645 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1253 (V1253A)
Ref Sequence ENSEMBL: ENSMUSP00000143029 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098603] [ENSMUST00000196398]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098603
AA Change: V1245A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000096203
Gene: ENSMUSG00000040943
AA Change: V1245A

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1203 1819 7e-301 SMART
low complexity region 1832 1844 N/A INTRINSIC
low complexity region 1885 1897 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000196398
AA Change: V1253A

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000143029
Gene: ENSMUSG00000040943
AA Change: V1253A

DomainStartEndE-ValueType
low complexity region 690 701 N/A INTRINSIC
low complexity region 855 862 N/A INTRINSIC
low complexity region 884 895 N/A INTRINSIC
low complexity region 899 921 N/A INTRINSIC
Tet_JBP 1211 1827 3.4e-305 SMART
low complexity region 1840 1852 N/A INTRINSIC
low complexity region 1893 1905 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197211
Predicted Effect unknown
Transcript: ENSMUST00000198974
AA Change: V42A
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199176
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199381
Coding Region Coverage
  • 1x: 98.9%
  • 3x: 97.9%
  • 10x: 94.8%
  • 20x: 87.9%
Validation Efficiency
MGI Phenotype Strain: 5285413; 4345275; 3813933; 5301343
Lethality: D1-D2
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a methylcytosine dioxygenase that catalyzes the conversion of methylcytosine to 5-hydroxymethylcytosine. The encoded protein is involved in myelopoiesis, and defects in this gene have been associated with several myeloproliferative disorders. Two variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Mice homozygous for a gene trapped allele die shortly after birth and exhibit a loss of acidic granules in the proximal convoluted tubules of the kidneys. Mice homozygous for a conditional allele activated in hematopoeitic compartment exhibit self-renewal and myeloid transforamtion. [provided by MGI curators]
Allele List at MGI

All alleles(1246) : Targeted(6) Gene trapped(1240)

Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921509C19Rik T C 2: 151,472,904 N285D possibly damaging Het
9230110C19Rik T G 9: 8,022,456 N255T probably benign Het
Adam9 T G 8: 24,993,109 M227L probably benign Het
Ankrd35 A G 3: 96,678,155 D21G probably damaging Het
Arhgap32 C T 9: 32,260,085 A1387V probably benign Het
Atg4d T A 9: 21,270,801 V306E probably damaging Het
Brsk1 G A 7: 4,704,251 V268M probably damaging Het
Clec4a4 A G 6: 123,012,799 E133G possibly damaging Het
Col24a1 T A 3: 145,460,838 L1076H probably damaging Het
Ddah1 G T 3: 145,889,109 R208L probably benign Het
Dysf A G 6: 84,113,386 N960S probably benign Het
Egln2 A G 7: 27,160,371 Y306H probably damaging Het
Fgfr1 T C 8: 25,562,276 V293A possibly damaging Het
Gja3 A G 14: 57,036,385 Y177H probably damaging Het
Glul T A 1: 153,907,099 probably null Het
Gprc5a G A 6: 135,079,247 V231I probably benign Het
Kdm4d C A 9: 14,464,395 A56S probably damaging Het
Lingo4 G A 3: 94,399,392 probably benign Het
Map6 A G 7: 99,268,214 T65A probably damaging Het
Mmrn2 T C 14: 34,399,132 I653T probably benign Het
Ndufa12 A G 10: 94,203,314 T70A probably benign Het
Nfe2l3 C A 6: 51,457,764 P435T possibly damaging Het
Npc1l1 A T 11: 6,228,174 V412E possibly damaging Het
Olfr303 A T 7: 86,394,595 F301Y probably damaging Het
Olfr33 A T 7: 102,713,998 Y138* probably null Het
Pcnx T C 12: 81,973,234 F1344L probably damaging Het
Pi4ka A G 16: 17,363,954 V297A probably benign Het
Pole2 G A 12: 69,207,929 L381F probably benign Het
Pramel7 T C 2: 87,489,723 T409A probably benign Het
Proc C G 18: 32,123,398 M405I probably damaging Het
Serinc2 C A 4: 130,264,340 A105S probably damaging Het
Slc4a10 G T 2: 62,286,930 K744N probably damaging Het
Spdye4c A T 2: 128,596,558 I279F probably damaging Het
Srcap G T 7: 127,530,650 R568L probably damaging Het
Stag3 T A 5: 138,311,735 M1215K probably benign Het
Tenm3 C T 8: 48,279,048 A1274T possibly damaging Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Trip12 T C 1: 84,759,100 I800V probably benign Het
Zfc3h1 T C 10: 115,412,108 I1072T probably benign Het
Zfp148 T A 16: 33,495,465 probably null Het
Zfp941 A G 7: 140,812,774 V224A probably benign Het
Other mutations in Tet2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00341:Tet2 APN 3 133488085 missense possibly damaging 0.96
IGL00401:Tet2 APN 3 133466882 missense possibly damaging 0.72
IGL01528:Tet2 APN 3 133480298 missense possibly damaging 0.86
IGL02053:Tet2 APN 3 133488523 missense possibly damaging 0.96
IGL02142:Tet2 APN 3 133480139 missense possibly damaging 0.96
IGL02512:Tet2 APN 3 133469308 missense probably benign 0.05
IGL03148:Tet2 APN 3 133481363 missense probably benign 0.18
IGL03182:Tet2 APN 3 133471398 nonsense probably null
IGL03371:Tet2 APN 3 133467551 missense possibly damaging 0.71
P0022:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0023:Tet2 UTSW 3 133486893 missense probably benign 0.01
P0031:Tet2 UTSW 3 133480202 missense possibly damaging 0.53
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0012:Tet2 UTSW 3 133476558 missense probably damaging 0.98
R0463:Tet2 UTSW 3 133486666 missense possibly damaging 0.86
R0522:Tet2 UTSW 3 133466804 missense probably damaging 0.98
R0593:Tet2 UTSW 3 133488109 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467602 missense probably benign 0.00
R0600:Tet2 UTSW 3 133467725 missense probably benign 0.01
R0698:Tet2 UTSW 3 133467384 missense probably benign 0.32
R0723:Tet2 UTSW 3 133467284 missense probably benign
R0726:Tet2 UTSW 3 133468184 missense probably benign
R0747:Tet2 UTSW 3 133467470 missense possibly damaging 0.86
R1006:Tet2 UTSW 3 133476601 missense possibly damaging 0.53
R1382:Tet2 UTSW 3 133476615 missense probably damaging 1.00
R1550:Tet2 UTSW 3 133469519 missense probably benign 0.32
R1647:Tet2 UTSW 3 133485880 missense probably benign
R1662:Tet2 UTSW 3 133466852 missense possibly damaging 0.96
R1727:Tet2 UTSW 3 133487290 missense probably damaging 0.98
R1738:Tet2 UTSW 3 133481387 missense probably benign 0.08
R1749:Tet2 UTSW 3 133480131 critical splice donor site probably null
R1869:Tet2 UTSW 3 133481441 splice site probably null
R1887:Tet2 UTSW 3 133487333 missense possibly damaging 0.68
R1937:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1939:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1940:Tet2 UTSW 3 133488638 missense possibly damaging 0.68
R1997:Tet2 UTSW 3 133486589 nonsense probably null
R2082:Tet2 UTSW 3 133485727 missense possibly damaging 0.96
R2084:Tet2 UTSW 3 133487767 missense possibly damaging 0.68
R2215:Tet2 UTSW 3 133486601 missense probably benign 0.03
R2321:Tet2 UTSW 3 133486339 missense possibly damaging 0.53
R2873:Tet2 UTSW 3 133486954 missense probably damaging 1.00
R3439:Tet2 UTSW 3 133466831 missense possibly damaging 0.93
R3783:Tet2 UTSW 3 133479363 missense possibly damaging 0.53
R3894:Tet2 UTSW 3 133469477 missense possibly damaging 0.86
R3916:Tet2 UTSW 3 133486055 missense possibly damaging 0.53
R3966:Tet2 UTSW 3 133487657 missense possibly damaging 0.73
R4457:Tet2 UTSW 3 133485563 missense possibly damaging 0.85
R4633:Tet2 UTSW 3 133485549 missense probably benign 0.33
R4646:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4647:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4648:Tet2 UTSW 3 133488082 missense probably benign 0.02
R4691:Tet2 UTSW 3 133486083 missense possibly damaging 0.73
R4805:Tet2 UTSW 3 133467315 missense probably benign 0.32
R4829:Tet2 UTSW 3 133476620 missense possibly damaging 0.91
R4901:Tet2 UTSW 3 133467044 missense possibly damaging 0.86
R4975:Tet2 UTSW 3 133486759 unclassified probably benign
R5004:Tet2 UTSW 3 133487379 missense possibly damaging 0.84
R5075:Tet2 UTSW 3 133486906 missense probably benign
R5137:Tet2 UTSW 3 133476565 missense probably benign 0.32
R5324:Tet2 UTSW 3 133485913 missense probably benign 0.00
R5590:Tet2 UTSW 3 133476480 splice site probably null
R5854:Tet2 UTSW 3 133487885 missense probably damaging 0.98
R5856:Tet2 UTSW 3 133486640 missense probably benign 0.01
R5865:Tet2 UTSW 3 133487099 missense probably benign 0.08
R5879:Tet2 UTSW 3 133487960 missense possibly damaging 0.96
R5935:Tet2 UTSW 3 133488535 missense possibly damaging 0.68
R6012:Tet2 UTSW 3 133466781 missense possibly damaging 0.86
R6075:Tet2 UTSW 3 133471435 missense possibly damaging 0.71
R6181:Tet2 UTSW 3 133487759 nonsense probably null
R6188:Tet2 UTSW 3 133480326 missense probably benign 0.18
R6339:Tet2 UTSW 3 133486417 missense possibly damaging 0.53
R6612:Tet2 UTSW 3 133487335 missense possibly damaging 0.53
R6923:Tet2 UTSW 3 133479341 critical splice donor site probably null
R6934:Tet2 UTSW 3 133483237 critical splice donor site probably null
R7076:Tet2 UTSW 3 133467023 missense possibly damaging 0.71
R7155:Tet2 UTSW 3 133469591 missense possibly damaging 0.71
R7184:Tet2 UTSW 3 133473630 missense probably damaging 0.98
R7200:Tet2 UTSW 3 133487192 missense probably benign 0.18
R7459:Tet2 UTSW 3 133480289 missense possibly damaging 0.53
R7504:Tet2 UTSW 3 133487339 missense probably benign 0.33
R7524:Tet2 UTSW 3 133480229 missense probably benign 0.33
R7613:Tet2 UTSW 3 133466748 missense possibly damaging 0.83
R7653:Tet2 UTSW 3 133486385 missense probably benign 0.18
R7691:Tet2 UTSW 3 133486849 missense probably damaging 0.98
R7770:Tet2 UTSW 3 133480295 missense possibly damaging 0.53
R7807:Tet2 UTSW 3 133486541 missense possibly damaging 0.53
R7813:Tet2 UTSW 3 133473643 missense probably benign 0.06
R7978:Tet2 UTSW 3 133487665 missense possibly damaging 0.96
R8055:Tet2 UTSW 3 133467992 missense possibly damaging 0.93
R8164:Tet2 UTSW 3 133467134 missense possibly damaging 0.85
R8236:Tet2 UTSW 3 133487786 missense probably benign 0.00
R8755:Tet2 UTSW 3 133488278 missense probably damaging 0.99
R8962:Tet2 UTSW 3 133488043 missense probably benign 0.22
X0021:Tet2 UTSW 3 133486295 missense possibly damaging 0.85
X0066:Tet2 UTSW 3 133488373 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GGCTGCCCCATACATGAAAAGGA -3'
(R):5'- CCCAGTGGAGGCTTGTGTTTACAAA -3'

Sequencing Primer
(F):5'- agaagtgggagtgggtgg -3'
(R):5'- GACTGTGTCATGTCTAAATGCAT -3'
Posted On2014-03-14