Incidental Mutation 'R4432:Cdk14'
ID381241
Institutional Source Beutler Lab
Gene Symbol Cdk14
Ensembl Gene ENSMUSG00000028926
Gene Namecyclin-dependent kinase 14
SynonymsPftk1
MMRRC Submission 041701-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4432 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location4803391-5420312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5036427 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 298 (W298R)
Ref Sequence ENSEMBL: ENSMUSP00000111112 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030763] [ENSMUST00000115450] [ENSMUST00000115451] [ENSMUST00000115452]
Predicted Effect probably damaging
Transcript: ENSMUST00000030763
AA Change: W316R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030763
Gene: ENSMUSG00000028926
AA Change: W316R

DomainStartEndE-ValueType
low complexity region 119 127 N/A INTRINSIC
S_TKc 135 419 3.63e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115450
AA Change: W270R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111110
Gene: ENSMUSG00000028926
AA Change: W270R

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115451
AA Change: W270R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111111
Gene: ENSMUSG00000028926
AA Change: W270R

DomainStartEndE-ValueType
low complexity region 73 81 N/A INTRINSIC
S_TKc 89 373 3.63e-85 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115452
AA Change: W298R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111112
Gene: ENSMUSG00000028926
AA Change: W298R

DomainStartEndE-ValueType
low complexity region 101 109 N/A INTRINSIC
S_TKc 117 401 3.63e-85 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133465
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156660
Meta Mutation Damage Score 0.9745 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (42/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PFTK1 is a member of the CDC2 (MIM 116940)-related protein kinase family (Yang and Chen, 2001 [PubMed 11313143]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6430573F11Rik A T 8: 36,498,478 I51F probably damaging Het
Abca6 T C 11: 110,241,588 M294V probably benign Het
Abcc5 A T 16: 20,368,187 probably null Het
Acsm4 A C 7: 119,711,387 E499A probably damaging Het
Adamtsl4 T C 3: 95,681,759 probably null Het
Ank2 A T 3: 126,947,806 probably benign Het
Anks6 G A 4: 47,044,905 Q334* probably null Het
Cadps2 T A 6: 23,626,738 I155L probably damaging Het
Casp4 G A 9: 5,323,653 R74H probably damaging Het
Chia1 A G 3: 106,115,325 N12D probably benign Het
Cyp3a59 A G 5: 146,104,786 D380G probably benign Het
Dnm2 T C 9: 21,491,304 probably benign Het
Dnm3 T C 1: 161,991,997 probably benign Het
Dpp4 A G 2: 62,345,112 Y660H probably damaging Het
Fam92b C A 8: 120,174,855 R37L probably damaging Het
H6pd T G 4: 149,995,758 Y202S probably damaging Het
Hnrnpa0 T C 13: 58,127,937 K126R probably benign Het
Insc C T 7: 114,769,055 probably benign Het
Lrrc45 G A 11: 120,715,221 probably null Het
Mapkap1 T C 2: 34,619,863 L263P probably damaging Het
Nmur1 A G 1: 86,387,565 S160P probably damaging Het
Olfr1254 A T 2: 89,788,734 M206K possibly damaging Het
Olfr1288 T A 2: 111,479,412 C209* probably null Het
Pcdhb15 A G 18: 37,475,512 N599S probably damaging Het
Pcid2 T C 8: 13,085,421 D196G probably damaging Het
Pcolce2 T C 9: 95,681,557 F199L probably damaging Het
Phf11c A T 14: 59,390,935 N88K possibly damaging Het
Prl8a8 T A 13: 27,510,480 Y109F probably benign Het
Rasa2 A G 9: 96,542,407 probably benign Het
Samhd1 T C 2: 157,104,893 D558G probably damaging Het
Slc1a1 T C 19: 28,902,709 F263S probably benign Het
Slc27a3 G A 3: 90,387,340 T408M probably damaging Het
Slc4a7 T A 14: 14,757,323 N520K probably damaging Het
Szt2 A G 4: 118,384,231 S1679P probably damaging Het
Vmn1r218 T C 13: 23,137,242 F173S possibly damaging Het
Vmn2r32 T A 7: 7,479,919 N19Y probably damaging Het
Other mutations in Cdk14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00678:Cdk14 APN 5 5249237 splice site probably benign
IGL01376:Cdk14 APN 5 5010839 missense probably damaging 1.00
IGL02102:Cdk14 APN 5 5380083 missense probably benign 0.01
IGL02179:Cdk14 APN 5 5103845 missense probably damaging 1.00
IGL02423:Cdk14 APN 5 4888905 missense probably benign 0.00
IGL03081:Cdk14 APN 5 4949527 splice site probably benign
IGL02988:Cdk14 UTSW 5 5036484 missense probably damaging 1.00
R0465:Cdk14 UTSW 5 5093019 missense probably damaging 1.00
R0630:Cdk14 UTSW 5 5135422 splice site probably benign
R1452:Cdk14 UTSW 5 4888927 missense possibly damaging 0.85
R1601:Cdk14 UTSW 5 5135378 missense probably damaging 1.00
R1629:Cdk14 UTSW 5 5103807 missense probably benign 0.18
R1659:Cdk14 UTSW 5 4949571 missense probably benign 0.08
R1809:Cdk14 UTSW 5 5010901 missense probably damaging 0.98
R2013:Cdk14 UTSW 5 5093047 missense probably damaging 1.00
R2015:Cdk14 UTSW 5 5380082 missense probably benign
R2256:Cdk14 UTSW 5 4888924 missense probably benign
R2257:Cdk14 UTSW 5 4888924 missense probably benign
R2908:Cdk14 UTSW 5 5249051 missense probably benign 0.33
R4324:Cdk14 UTSW 5 5036532 nonsense probably null
R4907:Cdk14 UTSW 5 5249140 missense probably damaging 0.96
R5426:Cdk14 UTSW 5 4888975 missense possibly damaging 0.93
R5708:Cdk14 UTSW 5 5266036 intron probably benign
R6006:Cdk14 UTSW 5 5249211 start codon destroyed probably null 0.33
R6120:Cdk14 UTSW 5 4894029 missense probably damaging 0.96
R7048:Cdk14 UTSW 5 5093005 missense probably damaging 1.00
R7104:Cdk14 UTSW 5 5195325 missense possibly damaging 0.92
R7712:Cdk14 UTSW 5 5380061 missense possibly damaging 0.86
R8046:Cdk14 UTSW 5 5249159 missense possibly damaging 0.86
Z1176:Cdk14 UTSW 5 5135322 nonsense probably null
Z1177:Cdk14 UTSW 5 4888894 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAAAGCCTCTGACCTTCTCC -3'
(R):5'- TTGGGATTTACAGCACCCGTTC -3'

Sequencing Primer
(F):5'- CTATTAAGAGGCCCCATCTGGAG -3'
(R):5'- GGGATTTACAGCACCCGTTCTTTTC -3'
Posted On2016-04-21